If a strand of DNA has the nitrogen base sequence, GCTAGATGCG, what will be
the sequence of the complementary strand?

Answers

Answer 1

Answer:

CGATCTACGC

Explanation:

Answer 2

The complementary strand of DNA to GCTAGATGCG is CGATCTAGCT.

The nitrogen bases in DNA are complementary to each other. This means that adenine (A) always pairs with thymine (T), and guanine (G) always pairs with cytosine (C).

The strand of DNA GCTAGATGCG has the following sequence of nitrogen bases:

G - guanineC - cytosineT - thymineA - adenineG - guanineA - adenineC - cytosineG - guanine

The complementary strand of DNA will have the following sequence of nitrogen bases:

C - cytosineG - guanineA - adenineT - thymineC - cytosineT - thymineG - guanineC - cytosine

The complementary strand is created by pairing the nitrogen bases in the original strand with their complementary bases. So, the guanine in the original strand pairs with the cytosine in the complementary strand, the cytosine in the original strand pairs with the guanine in the complementary strand, and so on.

To know more about the Sequence, here

https://brainly.com/question/29457800

#SPJ2


Related Questions

Mitosis and budding are similar beu
O
Both processes are components of sexual reproduction
The offspring produced by both are genetically diverse
In both, the genetic material comes from a single parent.
O O
Both processes are more common in animals than in plants.

Answers

Answer:

animals would be your awnser you are welcome  

Explanation:

PLS HELP ILL MARK BRAILIEST
Spend one minute writing an explanation of
the FUNCTION of enzymes. YOU MUST USE
THE WORDS CATALYST, ACTIVATION
ENERGY, RECYCLABLE

Answers

Like all catalysts, enzymes work by lowering the activation energy of chemical reactions. Activation energy is the energy needed to start a chemical reaction. This is illustrated in Figure below. The biochemical reaction shown in the figure requires about three times as much activation energy without the enzyme as it does with the enzyme.

The reaction represented by this graph is a combustion reaction involving the reactants glucose (C6H12O6) and oxygen (O2). The products of the reaction are carbon dioxide (CO2) and water (H2O). Energy is also released during the reaction. The enzyme speeds up the reaction by lowering the activation energy needed for the reaction to start. Compare the activation energy with and without the enzyme

Answer:

Enzymes help speed up chemical reactions in the human body. They bind to molecules and alter them in specific ways. They are essential for respiration, digesting food, muscle and nerve function, among thousands of other roles.

What is the function of an enzyme? They allow chemical reactions to occur at normal body temperature fast enough to sustain life. They reduce the activation energy needed to start a chemical reaction.

There are four steps in the process of an enzyme working. (1) An enzyme and a SUBSTRATE are in the same area. The substrate is the biological molecule that the enzyme will work on. (2) The enzyme grabs onto the substrate with a special area called the ACTIVE SITE.

There are four steps in the process of an enzyme working. (1) An enzyme and a SUBSTRATE are in the same area. The substrate is the biological molecule that the enzyme will work on. (2) The enzyme grabs onto the substrate with a special area called the ACTIVE SITE.

Enzymes create chemical reactions in the body. They actually speed up the rate of a chemical reaction to help support life. The enzymes in your body help to perform very important tasks. These include building muscle, destroying toxins, and breaking down food particles during digestion.

why cant you touch your palm to your shoulder? (on the same arm)

Answers

Answer: cause

Explanation:

Some people can some cant

Some people are left handed and some people are right handed

Which of the following is not a premise of Cell Theory?
l. All cells arise from other cells.
ll. All living cells require water for survival.
lll. All living things are only composed of cells.
Choose 1 answer:
a. I only
b. ll and lll
c. ll only
d. lll only

Answers

All cellsarisefromothercells a I only

In three to five sentences, construct an argument that shows why lichens are necessary to establish a new ecosystem after an extreme disturbance.
I would really appreciate it if someone o two people would help me out on this one

Answers

Answer:  Lichens affect every species in the ecosystem, in 2013 Russia had a dramatic lichen die off which caused 61,000, 20% of the entire reindeer population to die from starvation. And with fewer deers, the bears and wolves also suffered from the loss of lichens and if it takes a long time for lichens to grow back in an ecosystem, animal declines may take years if ever to be corrected.  Lichens serve as a basis for several food chains, especially in artic communities.

The argument which shows why lichens are necessary to establish a new ecosystem is as follows;

Lichens are known to enable algae to live all over the world in many different climates.

On this note, lichens also provide a means to convert carbon dioxide in the atmosphere through photosynthesis into oxygen, a process required by all to survive.

Additionally, lichens provide us with valuable information about the environment around us.

On this basis, lichens are important for establishing a new ecosystem after an extreme disturbance.

Read more on lichens and the ecosystem;

https://brainly.com/question/1504278

__________ is a method of wood harvesting that clears trees in an area in two or three cuts over several years.
A)
Seed-tree cutting
B)
Parthenocarpy
C)
Shelterwood cutting
D)
Selective cutting
E)
Clearcutting

Answers

Answer: E

Explanation: clearcutting

I believe the correct answer is E. Clear-cutting

4.Paramecium is able to move by hairlike structures called
____

Answers

Answer:

Cilia

Explanation:

           

can someone write me a essay of Photosynthesis for 30 points URGENT!!! It has to be highschool level

Answers

Answer:

Here, I got u homie!

Explanation:

Photosynthesis is the process through which green plants and other specific living organisms utilize light energy to convert water and carbon dioxide in to simple sugars. Through photosynthesis, green plants are able to manufacture their own food which is essential for their growth.

Plz give brainliest

If water is polar, state a liquid that you think is nonpolar, and justify your answer

Answers

A gas. This is because none polar solvents contain binds between atoms with similar electronegativities, some examples are carbon and hydrogen

What form of energy is responsible for producing changes that occur in Earth’s hydrosphere?

Answers

Answer:

the sun because energy from the Sun heats the Earth unevenly. As a result, convection currents develop in the atmosphere and ocean. These redistribute heat in the atmosphere and oceans.

Answer: Hydropower is created when rapidly flowing water turns turbines inside a dam, generating electricity. Nuclear energy is produced at power plants by the process of nuclear fission. The energy created during nuclear reactions is harnessed to produce electricity.

PLEASE MARK ME BRAINLIST

which phase best describes meiosis I? ​

Answers

Answer:

Division of homologous chromosomes.

I hope it's helpful!

Soil erosion can be BEST prevented by

- Heavily watering the vegetation on the slope

- Increasing the slope of the land by adding more soil

- Building terraces into the sides of a slope

- removing grass from the steepest slope.

I need help!!

Answers

Answer: Following are some of the methods of soil erosion prevention: Plant trees on barren lands to limit erosion of soil. Add mulch and rocks to prevent the plants and grass underneath to prevent soil erosion. Mulch matting can be used to reduce erosion on the slopes.

Answer:

Building terraces into the sides of a slope

1) How is nondisjunction related to Down syndrome and other abnormal chromosome numbers?

2) State the differences between DNA and RNA

Pleaaseeee helllpppp :(((

Answers

1. Down syndrome is usually caused by an error in cell division called “nondisjunction.” Nondisjunction results in an embryo with three copies of chromosome 21 instead of the usual two. Prior to or at conception, a pair of 21st chromosomes in either the sperm or the egg fails to separate.


2. DNA contains the sugar deoxyribose, while RNA contains the sugar ribose.


DNA is a double-stranded molecule, while RNA is a single-stranded molecule.

Choose either one ^^^

Hope this helps you.

as a result of fertilization_____is formed​

Answers

Answer:

zygote

Explanation:

Fertilization is the process in which haploid gametes fuse to form a diploid cell called a zygote. To ensure that each zygote has the correct number of chromosomes, only one sperm can fuse with one egg.

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

SOMEONE PLEASE ANSWER OMG



Considering that different types of cells have different rates of mitosis,
which of the following would be a correctly finish this statement? Cell
types like skin and hair are damaged and need replaced more often than
liver cells; therefore ......
Liver cells would have MORE cells doing Mitosis and Apoptosis compared to
Skin/Hair cells
Liver cells would have LESS cells doing Mitosis and Apoptosis compared to Skin/Hair
cells
Liver cells would have the SAME amount of cells doing Mitosis and Apoptosis
compared to Skin/Hair cells

Answers

Answer:

OMGGGGHHHHVGGGGGGGGG

The farmer realizes he could sell mini-dragons as pets, but doesn't want them to breathe fire, because that would be dangerous. Suggest two parental genotypes for parents that would produce mini, non-fire breathing dragons.

Answers

Answer:

ddff  and DDFf

Explanation:

From the information given:

Let DD represents the dwarf traits and FF represents the ability for the dragons to breathe fire.

Also, if dd represents the normal traits and ff represents the inability of the dragons to breathe fire.

Then; we can cross a dominant trait for dwarfism which has a heterozygous trait for fire with a recessive trait of normal and nonfire.

The two parental gametes are: ddff  and DDFf

Using a Punnet Square:

         DF              Df

df      DdFf           Ddff

df      DdFf           Ddff

From above; we could observe that the proportion of progenitors that will be dwarf and at the same time unable to breathe fire is 50%.

thinks mrs. Clack that finned tetrapods developed "hands" before or after migrating to land​

Answers

Big fat juicy titsdood

Answer:

what am i supposed to anwser? should I prove her wrong?

Explanation:

Kerstin is getting ready to graduate high school. She wants to become a cardiac perfusionist. Which best describes the path she should take to her career?

Answers

Answer:

four-year degree , master’s degree , certification exam from ABCP

Explanation:

Answer:

She should do a four-year degree , master’s degree , certification exam from ABCP

Explanation:

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Which component of the endomembrane system is responsible for packaging and preparing exist proteins in vesticles?

Answers

Answer: Golgi apparatus

Explanation: The Golgi is responsible for packaging sorting tagging and distribution.

Hope this is helpful :)

HELP ME WITH THIS PLEASE I REALLY NEED HELP I WILL GIVE U BRAINLY IF U GET IT RIGHT !!

Answers

The answer is b because it prey wouldn’t be able to eat it

The codon GAG becomes GTG due to a point mutation in the DNA, affecting the structure of the protein hemoglobin. What effect does this mutation have on the individual? WILL GIVE BRAINLIEST
The individual suffers from sickle cell anemia.

The individual suffers from myotonic dystrophy.

The individual suffers from Fragile X syndrome.

The individual suffers no negative effects.

Answers

i believe it to be the first one

Answer:

The individual suffers from sickle cell anemia.

Explanation:

Deformed red blood cells occur in 1 in 500 African Americans. This is caused due to a gene mutation called point mutation that alters the structure of the red blood cell. This alteration affects the cell's ability to carry oxygen.

What is a complex Sugar? Please a specific answer(make more sense)

Answers

Answer:

Complex carbohydrates are MADE up of sugar molecules that are strung together in long complex chains, complex carbohydrates are found in food like peas, beans, whole grains and vegetables.

Explanation:

Both SIMPLE and COMPLEX carbohydrates are turned into glucose (blood sugar) in the body and are used as energy.

I really hoped this helped some, I tried to make it specific :[

What is often a problem when calibrating a molecular clock?
A. There are frequently not enough negative mutations to accurately calibrate the clocks.
B. There are many different clocks, each of which "ticks" at a different rate.
C. The clocks use mutations that are difficult to identify and track.
D. The frequency of crossing over is used to calibrate the clocks.​

Answers

Answer:

cevabın C olduğunu düşünüyorum

PLS HELP!!!! 10PTS

Reproduction is not a life process still organisms spend a lot of energy on it. Give reason.

Answers

To keep their bloodline running.

Answer:

Reproduction is not a life process, but still organisms spend a lot of energy on it. ... The reproduction is not necessary to ensure living but it is required to ensure that the continuation of the living organisms and generations of the next cycle of living. It is necessary for ensuring the stability of the population.

Reproduction also helps in increasing the population of the species. All the processes which are necessary to maintain life in an organism are called life processes. Reproduction is not considered a life process because it is not necessary to maintain life.

The energy produced by respiration is the in the form of adenosine triphosphate or ____________​

Answers

Answer:

ATP

Explanation:

Adenosine triphosphate

I HAVE BEEN STUCK HERE FOR 5 MINUTES...!

Answers

vague repetitive pictures

Answer:

Should be C

Explanation:

D is wrong because standing out should mean they are spotted more easily, which means they get hunted down more often/ prey spot them easier

B is kind of weird because larger population = more competition, and I remember owls work alone

A is suspicious because they are both tawny owls and I don't understand how less food they need to be significant

C sounds plausible because the gray feather can be a "stronger" gene or something

If a cell has 40% solute and is placed in a solution with 60% water what will happen to the cell

Answers

There will be no net movement of water in or out of the cell.

Water moves out of the cell when a cell is placed in a hypertonic solution. This is a solution that contains more solute than does the cell. When a cell is placed in a hypotonic solution, water enters into the cell from the solution until the cell finally bursts. However, if the cell and the solution contain the same amount of solute, there is no net movement in or out of the cell.

We can see here that the cell has 40% solute and is placed inside a solution that has 60% water. This means that the solution also contains 40% solute. There will be no net movement of water in or out of the cell.

Learn more: https://brainly.com/question/2673886

A condition that describes an individual that carries two different alleles of a gene.

Answers

Answer:

Het erozygous

Explanation:

People with alleles that are the same are hom ozygous for the physical trait. Ones with two different alleles are het erozygous.

There is no space, just didn't let me spell it correctly.

Other Questions
Germanys GPD... ??? Please help, I beg of y'all FIND BD - Pease help me this is a really hartd problem Encierra todo los nmeros que sean menores para 25,000 003 Uptown towing company charges $60 to tow a car plus $25 per day for vehicle storage. Downtown Towing company charges $75 for towing plus $20 per day for vehicle storage. Write the two equations for the companies Which inequality is equivalent to 10x 5y 30?y -2x + 6y -2x - 6y -2x + 6y -2x - 6 Ms. Mathews wants to put a fence around the north, south and east sides if her square garden. The garden has an area of 100ft2. How much fencing does she need? How can weak acids and weak bases cause pH stress to cells?a. Weak bases will only cause pH stress at low pH. b. If a cell has transporters that are not well regulated, weak acids or weak bases can accumulate inside the cells and cause stress. c. Only weak acids can cause stress by diffusing across a membrane at low pH. d. At certain pH levels, both weak acids or weak bases will be uncharged, and thus are small uncharged molecules that can diffuse across a membrane and cause pH stress inside the cell. e. Weak acids and weak bases do not cause stress. hope someone can help me Rob is saving to buy a new MP3 player. For every $14 he earns babysitting, he saves $7. On Saturday, Robearned $84 babysitting. How much money did he save?If he earned $84, how much money did he save Boden's account has a principal of $300 and a simpleinterest rate of 3.6%. Complete the number line. How muchmoney will be in the account after 4 years, assumingBoden does not add or take out any money?years23and the missing year value is 1In the double number line, the missing interest value is(Type integers or decimals.)Enter your answer in the edit fields and then click Check Answer.Check AnswerClear All1partremaininglof 11BackNext B. En la siguiente tabla se muestran algunos valores de la base y la altura de distintos rectngulos cuya rea es la misma.Anoten los datos que faltan.34Base (b)2Altura (h)24a) Cul es el rea de los rectngulos?84La relacin entre los valores de la tabla es de proporcionalidad directa, inversa, o ninguna de las dos?En caso de que haya proporcionalidad, cul es la constante de proporcionalidad? A vehicle starts to move from the rest gets an acceleration of 5 m/s2 within 2seconds. Calculate the velocity and distance covered by the vehicle within the given time. Manufacturers of large equipment such as aircraft and ships and companies involved in road construction have jobs that may require two or more years for completion. For example, Boeing Corporation might have an order for 50 aircraft for a particular airline, and the order will extend over a three- to five-year period. Aircraft are delivered as completed, but not in a batch of 50 at one time. In the typical fashion, the overhead application rate must be calculated and applied in such a way that each aircraft that is delivered has the proper amount of overhead for that aircraft. Required: What unique difficulties do you see in the calculation and application of overhead in industries such as aircraft manufacturing or shipbuilding what is insomnia ?... can you please help me Each external force acts on the system for 10 seconds. Rank the change in momentum of each of the cart-cart systems from largest to smallest. (The label of m or 2 m desginates the relative mass of each cart.)It is possible to have some of the categories below BLANK since you may have items that are EQUAL to each other.Put the largest as far up as you can, and the smallest as far down as you can The ratio of girls to boys on a soccer team is 2 to 3. If there are 15 boys on the team, how many are girls? Let g = the number of girls on the team. Set up a proportion for this word problem. Help!!! 30 Points!!! Which short story do you imagine would require the most research on its historical and cultural context? A. a short story set in Alabama in the 1940s B. a short story set in Ethiopia in 1990 C. a short story set in France in 1730 D. depends upon the reader and his/her prior knowledge