I really need help!! Which lists the order of structures that air passes through on its way into the lungs? A. Nose, trachea, bronchi, pharynx. B. Nose, bronchi, trachea, pharynx. C. Nose, pharynx, trachea, bronchi. D. Nose, pharynx, bronchi, trachea

Answers

Answer 1

Answer:

Im pretty sure it's C I help my sister with her collage class for this sorta thing and if I remember correctly this is correct :)

have a great day


Related Questions


Can angiosperms be considered male or female?


Answers

The male structure makes the sperm (pollen) and the female have ovaries (which is eggs). So apart of the male.

Here's your answer: Their male

need help asap, will mark brainliest. PLSSS
How would an increase in the amount of solar energy available most likely affect a terrestrial community?

The amount of atmospheric carbon would decrease.
The amount of nitrogen in biomass would decrease.
The amount of sedimentary phosphorus would increase.
The amount of water in reservoirs would increase. (ik its not this one)

Answers

The correct answer is C.

The amount of sedimentary phosphorus would increase.

Have a great day! Mark if correct!

The human body is made up of several
systems. Each of these systems works
together to maintain homeostasis in the
organism. For example, the respiratory
system takes in oxygen and the oxygen is
transported through the body by the
cardiovascular system. The human body is
an example of
A. an open system.
B. a closed system.
C. a neutral system.

Answers

A jffnnffnfnfnfnhjgjggjgj
answer is A open system

WILL GIVE BRAINLIEST IF CORRECT
Roses now come in several colors such as orange and purple. Which process are florist most likely to use in creating these new flowers?
a. Genetic cloning
b. Protein synthesis
c. Artificial selection
d. Asexual reproduction

Answers

C reason is because if it was eight then it would be the same color since it is cloning it can’t be beer because it has nothing to do with synthesis and I can’t be d because if it was a sexual reproduction it would be like a because it would be the same as the parents The only way that I see is because an artificial selection we pick what colors go together which is The only possible correct choice

When two organisms from the same species compete for resources, it is______ competition.

Answers

Answer:

Intraspecific competition

Hope this helps!

Answer:

Competitive exclusion principal applies.

Explanation:

Basically, the chances of both species being equally successful is almost impossible. Chances are one will lose and will either leave empty-handed, injured, or won't live to leave at all.

Which organisms are secondary consumers in this food web? Select all that apply

Answers

Rockskipper, Pufferfish and Peacock Flounder

Rockskipper, Pufferfish and Peacock Flounder are secondary consumers in this food web. So, the correct options are A, B and C.

What is Food web?

A food web is a diagram that shows what is eaten with what in an ecological context and how food chains naturally connect to one another. Consumer-resource system is another term for the food web.

A food web is a comprehensive account of the species that make up an ecosystem and their interactions with one another. It demonstrates how energy is moved along food chains that are connected to other food chains.

After primary consumers, who are primarily herbivores, are omnivores, carnivores, and secondary and tertiary consumers. The apex predators are those animals that have no other predators save humans. They are at the highest point in the food chain.

Therefore, the correct options are A, B and C.

Learn more about Food web, here:

https://brainly.com/question/18816028

#SPJ2

Those individuals that are better able to survive in the Environment tend to be:

Answers

Answer:

Fit

Explanation:

They are the ones who are strong enough to survive.

Which of the following correctly describes how DNA contributes to the traits that appear in offspring? A) DNA contains the instructions for building RNA, which influences traits. B) DNA contains the instructions for building proteins, which create the physical traits of offspring. C) DNA contains the instructions for building carbohydrates, which are responsible for the physical traits of offspring. D) DNA contains the instructions for building enzymes, which catalyze chemical reactions for the traits of offspring.

Answers

a dna contains the instructions

DNA attributes to the genotype preference to the individual.  DNA contains the instructions for building RNA, which influences traits. The correct statement is answer A.

What is the full form of DNA ?

DNA stands for deoxyribonucleic acid.

DNA contains the orders that are needed for any organism in order  to develop, survive as well as reproduce. To carry out these duties, DNA sequences are needed to be converted into messages which can be used to produce proteins in  which are the complex molecules that are  doing  most of work in our body.

Since we have two pairs of chromosomes and we also have two pairs of genes in which  one  is from our father and one is  from mother. These pairs of genes then determine certain physical features or traits.

Learn more about DNA at :

https://brainly.com/question/264225

#SPJ2

PLEASE HELP


The theory of plate tectonics is supported by evidence that crustal plates move relative to each other. How does this observation support the theory of plate tectonics?
It suggests that plates are dragged around by ocean currents.
It suggests that plates are dragged around by air currents.
It suggests that plates can move independently of one another.
It suggests that plates cannot move independently of one another.

Answers

Answer:

Its c the third answer

Explanation:

LOOK AT PIC!!!!!!!!!!!!!

Answers

Answer: black

Explanation:

Yes

Answer:

wow it is blank

Explanation:

I NEEEEEDDDD HELP PLEASE

Answers

Answer:

Proteins.

Explanation:

Genes contain instructions to  assemble amino acids in proteins.

Identify the structures of plants usually involved in vegetative reproduction

Answers

Answer:

b

Explanation:

dnakebtearyrea

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

What are some things you think would help identify a fossil? *

Answers

Answer: by studying the Fossil record we can tell how long life has existed on earth,and how different plants and animals are related to each other.often we can work out how and where they lived, and use this information to find out about ancient environments fossils can tell us about a lot about the past.

Explanation: If you like it please mark brainlest....

can you please answer these questions for me I really need help I am begging you

Answers

Answer:

1: 75%

2: 75%

3: 50%

4: 25%

GIVING BRAINLIEST AND THE REST OF MY POINTS!!!! :)



What life cycle adaptation does the desert gold poppy have that helps it reproduce and survive in its dry desert environment?

A) It produces large amounts of spores.
B) It only produces seeds in the summer when it is driest.
C) Its seeds stay dormant until there is enough precipitation for them to grow.
D) It can produce seeds all year round that can grow in dry and wet conditions.

Answers

The answer is c. It hides its seeds until it is wet enough for them to reproduce.

What are some physical properties of the sun?

Answers

Answer:

Mass: 1.98892 x 1030 kg.

Diameter: 1,391,000 kilometers.

Radius: 695,500 km.

Surface gravity of the Sun: 27.94 g.

Volume of the Sun: 1.412 x 1018 km3

Density of the Sun: 1.622 x 105 kg/m3

Explanation:

How does the motion of particles in a gas change as the gas cools? (1 point)
They move more slowly.
b
They move in a more circular pattern.
ос
They move faster.
d
They move more randomly.

Answers

that link it takes all your information help

1. In the diagram, the arrow #9 is pointing to an organelle called





mitochondria
nucleus
smooth endoplasmic recticulum
endoplasmic recticulum

Answers

Answer:

Mitochondria

Explanation:

Why don't individuals with Tay-Sachs pass on the Tay-Sachs
allele?
a
Tay-Sachs disease is a recessive human genetic
disorder.
b Carriers are not affected.
c Affected individuals do not have children.

Answers

Answer:

Affected individuals do not have children.

Explanation:

8. Which is an example of a medium of communication?
in an office setting
letting people know that Fridays will not have casual dress
a formal speech at a meeting
a person objecting to a point that has been made

Answers

the answer is pier as

How does type 1 diabetes affect the cardiovascular system?

Answers

Answer:

diabetes can damage your blood vessels and the nerves that control your heart and blood vessels, causing to have a bad affect on your cardiovascular system.

In rabbits, spotted coat (S) is dominant to solid color (s) and black (B) is dominant to brown (b). A true-breeding black spotted rabbit is mated to a true-breeding brown solid rabbit to produce a heterozygous F1 generation. Two F1 individuals are mated, and you do not see a 9:3:3:1 (black spotted: black solid: brown spotted: brown solid) ratio of offspring, but instead see that almost all offspring are a non-recombinant phenotype. This tells you that

Answers

Answer:

Epistasis effect result into these offspring

Explanation:

Given

spotted coat (S) is dominant to solid color (s) and black (B) is dominant to brown (b)

Genotype of true-breeding black spotted rabbit BBSS

Genotype of  true-breeding brown solid rabbit bbss

Genotype of offspring BbSs

In normal crossing between BbSs and BbSs offspring of F1, should produce offspring in the ratio 9:3:3:1

But it does not happens in this case the simple reason could be  presence of Epistasis in which the alleles assort independently but do not express themselves because of the following reasons -

a) Interaction between two or more loci thereby resulting into new phenotypes

b) An allele at one locus masks effects of other allele at one or more loci

c) Allele at one locus modifies the effects of alleles at one or more other loci

what was explained by darwins theory of biological evolution

Answers

Answer:

When Organism A has a trait that negatively impacts it, or lacks a trait which would positively impact it, then said organism perishes, and its genes are not passed onto the next generation. On the flip side, when Organism B has a trait that positively impacts it, or lacks a trait that would negatively impact it, then the organism thrives, and its genes are passed onto the next generation.

Therefore, the next generation receives genes from Organism B and does not receive genes from Organism A. So, the next generation has traits that positively impact it and lacks traits that would negatively impact it, thus evolving according to Darwin.

Explanation:

What was explained by it? Evolution. But how did it explain evolution? That is in the answer.

Which statement best describes the movement of ocean waves? Water moves across the ocean's surface water remains in the same place as wave (energy) travels through it water moves because there is a difference in density of the water creating a wave none of these

Answers

Answer:

water remains in the same place as wave (energy) travels through it

Explanation:

Winds influence the ocean and its movements. Air current running on the ocean surface transfers energy to water. A wave is nothing else than energy. When the winds provide energy to the water surface and produce waves, it occurs a particular water molecules´ motion. They move in circles from up to down, up to a certain depth, and go back to the surface. And they do so while energy from the wave is passing through. Waves are the ones that move through the ocean until they reach the shore, where the energy is transferred to land. Water molecules remain in the same general area, while energy travels from molecule to molecule as a wave.

List 4 chordate characteristics.

Answers

Answer:

notochord, dorsal hollow nerve cord, pharyngeal slits, and a post-an4l tail

Explanation:

had to censor second to last word but the 4 is an a

What is true about one strand of DNA?


It contains many chromosomes.


It contains many proteins.


It contains many pieces of RNA.


It contains many genes.

Answers

Answer:

it contains many genes.

Answer:

D: It contains many genes

The picture shows a giraffe eating leaves.
Which describes the interaction?
abiotic interacting with abiotic
Obiotic interacting with biotic
abiotic interacting with biotic
Obiotic interacting with abiotic

Answers

Answer:

biotic interacting with biotic

Explanation:

both the giraff and leaves are living and both are biotic

what is the term for the process of cell division that results in the formation of gametes ?​

Answers

Answer:

meiosis

Explanation:

A scientist is studying a substance that is cycled through ecosystems. Which of the following substances might the scientist be studying?
soil
copper
glucose
nitrogen
Will report scammers so pls just help me out

Answers

I think the answer is Glucose
Other Questions
pls help 15 points Read the passage below from The First Men in the Moon.The night was dark and overcast. Two yellow pinpoints far away showed the passing of a ship, and nearer was a red glare that came and went.Which mood is implied by the use of imagery above?suspenseisolationdepressionhostility Federalist Paper #10 was written in response to Shays' Rebellion and attempted to convince the public that what was needed in the U.S. government? A. Stronger state governments. B. More power to the central government. C. Political parties to settle disputes. Correct the errors in the sentence below. If there are no errors, leave the sentence as is.Big cats can be found in both north and south America. If a train travels 156 miles in 4 hours how many miles per hours dose it travel Pls help me with this... romeo and juliet question!! please help ^^ Which set of measurements makes it possible to draw a unique triangle?Atwo angle measures of 30 and 55Btwo side measures of 6 ft and 15 fttwo side measures of 15 ft and 10 ft, and a non-included angle measure of 25Dtwo angle measures of 35 and 50 and a non-included side measure of 7 ft Who painted the above image? Which statement best describes the cause and effect text structure?A ) It shows a problem and proposes a solution.B ) It is written in the order that events happened.C ) It shows how one event leads to another.D )It compares events, ideas, people, or things. If 15 ounces of candy cost $3.75, what is the unit price per ounce? Madison is preparing rice for 10 dinner guests. Each guesteats of a cup of rice.How many cups of rice does Madison need? If a triangle has sides with lengths of 10 inches 12 inches and 14 inches is a right triangle? Bob's Gift Shop sold 350 cards for Mother's Day. One salesman, Bentley, sold 2% ofthe cards sold for Mother's Day. How many cards did Bentley sell?Please help! 4The area that is circled is called the . The Ottoman Empire is located at . Austria-Hungary is located south of and west of . What is one result of nationalism? A. Feelings of rivalry between countries B. A desire to remain forever within the country C. Hatred of foreigners D. Love for all countries A team of science researchers is trying to decide which type of microscope to purchase for their laboratory. Compared to electron microscopes, a light microscope provides which of these drawbacks or disadvantages? A. uses electricity B. specimens cannot be alive C. lower magnification power D. more expensive to purchase and operate Can someone help me with this pls How does Ebola compare to other potential zoonotic diseases like SARS coronavirus, bird flu, or MERSA?Im so sick of getting bots on here. I havent gotten a real answer to the past ten questions Ive asked because of them. The hypotenuse of a certain triangle is 5 units long and one leg is 3 units long Did the area of the triangle How do you rewrite 4 5/7 as an improper fraction break it down into stepsplease don't use files