How many moles of NaCl are contained in 100.0 mL of a 0.20 M solution?​

Answers

Answer 1

Answer:

0.02 mol.

Explanation:


Related Questions

People are attempting to conserve natural resources, such as oil, gold, and aquifers because they are non-renewable resources. Why can't these resources be replaced?

Answers

Answer:

Natural resources are the resources that are available in the nature. There is no human involvement in the production or manufacture of the natural resources. These resources helps in adding capital and growth to the development of the country. Natural resources are found in abundance but they are non-renewable resources. This means that it takes millions of years for their formation. Once exhausted, their replacement would became very difficult. Conversation of the natural resources has been one of the global action. Developed nations are equipped to find ways by which natural resources can be saved and used in a way that they do not extinguish. Many alternative methods and techniques have been adopted to preserve them. Natural resources like oil, gold and coal are performed after going through a process of many years. Hence, there replacement becomes very challenging and difficult respectively.

Is the following reaction balanced or unbalanced?
2Fe2O3 + 3C → 4Fe + 3CO2

Answers

Answer:

unbalanced

hope this helps

Cu2(s)+O2(g)=Cu2O(g)+SO2(g)

please help urgent will give brainiest​

Answers

Answer:

2 Cu2S + 3 O2 = 2 Cu2O + 2 SO2

Explanation:

2 Cu2S + 3 O2 = 2 Cu2O + 2 SO2

Question 2 of 20
Based on their locations on the periodic table, which two elements would you
expect to form positive ions with a +3 charge?
A. Nitrogen, N.
B. Boron, B
C. Phosphorus, P
D. Aluminum, Al

Answers

A

Because Aluminum atoms tend to lose electrons in order to achieve an insert gas configuration. The aluminum atoms need to lose 3 electrons in order to attain the neon configuration , so it forms a trip of positive action

Answer:

Aluminium & Phosphorus (C & D)

Explanation:

Both these elements need to form positive ions with a +3 charge as they need to lose their 3 electrons to form a stable state in their configuration.

Please help!
Which tool was used to collect the solid product of the chemical reaction?

the balance
the funnel with the filter paper
the Erlenmeyer flask
the beaker
the watch glass
With this tool, the could be separated from the

Answers

Answer:
it's B
Explanation:

Answer: With this tool, the

✔ copper

could be

separated from the

✔ aqueous solution

.

Explanation:

EDU 2021

Which of the following is a difference between transition metals and halogens?

Transition metals are better at rock n roll
Transition metals are better at rock n roll,

Transition metals contain liquids while halogens are good insulators
Transition metals contain liquids while halogens are good insulators

Transition metals conduct electricity while halogens are reactive non-metals
Transition metals conduct electricity while halogens are reactive non-metals

Transition metals are poor conductors of electricity, while halogens have high densities

Answers

Transition metals conduct electricity while halogens are reactive non-metals

In your opinion,what will happen to a person who has sustained injury in the spinal cord?​

Answers

Answer: I think they get will paralysed and some of the impulses may not be able to get through.

Where does uranium, the main source of nuclear power, come from?

a.Uranium is produced by mining deposits of this mineral found in Earth’s crust.


b.Uranium is produced continually from light energy from the Sun.


c.Uranium is produced by the compaction of animal and plant matter in the earth.


d. Uranium is produced by the conversion of precious metals into a new substance.

Answers

Answer:

Uranium is produced by mining deposits of this mineral found in earth's crust

Can y’all please help me this is due tomorrow

Answers

1. Crust
2. Mesosphere
5. Mantle
4. Outer core
3. Inner core

Answer:

1,crust

2, mesosphere

3,Inner core

4,Outer core

5, Mantle

Which sets of elements have similar chemical and physical properties?

1. Mg and Ra 2. Al and P 3. Be and Ba 4. Na and Cl


1 & 2 ,


2 & 3


1 & 3

2 & 4

Answers

Answer:

1 & 3

Explanation:

Elements have similar chemical and physical properties if and only if they belong to the same group of elements in the periodic table.

A group of elements in the periodic table is a family of elements, the elements in the in the same group have the same number of valence electrons in their outermost shell, share similar chemical reactivity (with slight variation within the group) and similar physical properties  (with slight variation within the group).

Magnesium, radium, beryllium and barium all belong to group 2 hence they have similar chemical and physical properties.

I need help...

I need a lab conclusion on acids and bases.

Answers

Acids are proton donors, whereas bases are proton recievers. The more positive the charge on an atom, the higher its acidity. More concentrated electrons = more stable base = weaker acid. But electronegativity = more concentrated electrons. And electronegativity = stronger acid.

3 Module 1 - Lessons
Dashboard
Ready
C levertal
Infinite can
& 2nd
the amount of mass in a given space

Answers

Jdbshx s. Hs xj. Si. So uxbsiak. C

What is the number of moles of H2 produced when 23 g of sodium react with water according to the equation 2Na(s) + 2H2O(l)  2NaOH(aq) + H2(g)

Answers

Answer:

0.5 mole of H₂.

Explanation:

We'll begin by calculating the number of mole in 23 g of Na. This can be obtained as follow:

Mass of Na = 23 g

Molar mass of Na = 23 g/mol

Mole of Na =?

Mole = mass / Molar mass

Mole of Na = 23 / 23

Mole of Na = 1 mole

Next, the balanced equation for the reaction.

2Na + 2H₂O —> 2NaOH + H₂

From the balanced equation above,

2 moles of Na reacted to produce 1 mole H₂.

Finally, we shall determine the number of mole of H₂ produced by the reaction of 23 g (i.e 1 mole) of Na. This can be obtained as follow:

From the balanced equation above,

2 moles of Na reacted to produce 1 mole H₂.

Therefore, 1 mole of Na will react to produce = (1 × 1) / 2 = 0.5 mole of H₂.

Thus, 0.5 mole of H₂ is obtained from the reaction.

Which color of visible light would have the least energy? Which color of visible light would have the most energy?

Answers

Answer:

Red is the lowest.

Explanation:

Relative formula mass of carbon manoxide​

Answers

Explanation:

The relative formula mass of a substance, shown in grams, is called one mole of that substance. So one mole of carbon monoxide has a mass of 28 g, and one mole of sodium oxide has a mass of 62 g

Answer:

M(CO)=28 (g/mol)

Explanation:

M= 12+16=28 (g/mol)

A chlorine concentrations of 0.500 ppm is desired for water purification. What mass of chlorine must be added to 2500 L of water to achieve this level?

Answers

Answer:

50g

Explanation:

pls mark me brainliest right

why are metals poor choices for coffee mugs?

Answers

Answer:

They will stay too hot.

Explanation:

You would burn yourself on the mug and your drink would be too hot to drink.

Well they can rust if you don’t dry properly. But they can burn your hands because they conduct heat.

Why do cations and anions form?

Answers

Because an element can gain or lose and electrons so they take them away to become stable like a noble gas

is there a relationship between CO2 levels in average global temperatures

Answers

Answer:

Yes

Explanation:

A small part of the correspondence is due to the relationship between temperature and the solubility of carbon dioxide in the surface ocean, but the majority of the correspondence is consistent with a feedback between carbon dioxide and climate.

On the Periodic Table, which elements are predominantly (mostly) gases with low densities?

Alkali Metals,


Metalloids


Transition Metals

Non-Metals

Answers

I’m sorry if I wasted your time but I think it’s alkali metals but I’m
Not sure

Fill in the two blanks ​

Answers

Answer:

A.) Longer and Shorter

Explanation:

If the wavelength of a light wave is shorter that means the frequency will be higher.

That means that longer wavelengths have a lower frequency.

1. The chemical formula of caffeine is C8H10N4O2. Determine the percent composition of the molecule.
Show work please

Answers

Answer:

we find the mass for each element in one mole by multiplying the number of atoms in one molecule with the atomic mass

mC=8Ac=8*12=96g

mH=10AH=10*1=10g

mN=4AN=4*14=56g

mO=2AO=2*16=32g

by adding the masses together we find the molar mass of the molecule

M=mC+nH+mN+mO=96+10+56+32=194g/mole

we apply the rule of threes to find the percentage of each element

194g..96gC..10gH...56gN....32gO

100g....a...........b...........c.............d

a=(100*96)/194=49.48%C

b=(100*10)/194=5.19%H

c=(100*56)/194=28.85%N

d=(100*32)/194=16.48%O

Explanation:

Which solution will conduct electric current a sugar solution or a salt solution

Answers

Sugar is a nonconductor. When it dissolves into water it dissolves as a covalent molecule. As a covalent molecule it does not conduct electricity in the way that ionic compounds like salt would.

Is temperature and pressure directly proportional or inversely proportional?
A. Inversely proportional
B. Directly proportional

Answers

Directly proportional

6. Which of the following is not a characteristic of electromagnetic light waves?
O A. They can be reflected and refracted.
O B. They travel at the same speed through any one material.
O C. They can't travel through a vacuum.
O D. They obey the formula velocity = wavelength x frequency

Answers

B is the answer,I took the test

Answer:

B. They travel at the same speed through any one material.

Explanation:

Please help please with the answers

Answers

1) We know that rtp = number of moles × 24

                                 = 0.25 × 24

                                 = 6 dm³

Therefore the volume of 0.25 moles of gas at rtp is A) 6 dm³

3.1) Amount of Copper = 20 tonnes

Amount of pure copper from impure copper = 18 tonnes

Purity of copper = (Pure copper/ impure copper) × 100

                           = (18 / 20) × 100

                           = 18 × 5

                           = 90 %

Therefore the purity of copper is 90%

3.2) We know that oxygen has 8 protons and 8 neutrons, so the weight of oxygen molecule is 8 + 8 = 16 u

So, one mole of oxygen weighs 16 g, so 2 moles weigh 2 × 16 = 32 grams

But oxygen is diatomic so the weight is 32 × 2 = 64 grams

Therefore the weight of 2 moles of oxygen is 64 grams

3.3) Concentration of solution = Amount of solute/volume

                                                   = 4 moles/ 2 dm³

                                                   = 4 / 2

                                                   = 2 mol/dm³

Therefore the concentration of a solution containing 4 moles in 2 dm³ of solution is 2 mol/dm³

Happy to help :)

If you need any more help, fell free to ask

Extremely sorry for the late answer

If a gas is cooled from 315K to 231K and the volume is kept constant, what would the final pressure be if the original pressure was 621 mmHg ?

Answers

Answer:

455.4 mmHg

Explanation:

To solve this problem we can use Gay Lussac's Law, which describe the temperature and pressure of a gas, at constant volume and composition:

P₁T₂ =  P₂T₁

In this case:

P₁ = 621 mmHgP₂ = ?T₁ = 315 KT₂ = 231 K

We input the data:

621 mmHg * 231 K = P₂ * 315 K

And solve for P₂:

P₂ = 455.4 mmHg

How do the ideas of electrolytes and IV fluids relate?

Answers

Answer:

Electrolytes, particularly sodium, help the body maintain normal fluid levels in the fluid compartments because the amount of fluid a compartment contains depends on the amount (concentration) of electrolytes in it. If the electrolyte concentration is high, fluid moves into that compartment (a process called osmosis).

Explanation:

Answer:

Electrolytes are minerals in your body that have an electric charge. They are in your blood, urine, tissues, and other body fluids. Electrolytes are important because they help

Balance the amount of water in your body

Balance your body's acid/base (pH) level

Move nutrients into your cells

Move wastes out of your cells

Make sure that your nerves, muscles, the heart, and the brain work the way they should

Sodium, calcium, potassium, chloride, phosphate, and magnesium are all electrolytes. You get them from the foods you eat and the fluids you drink.

The levels of electrolytes in your body can become too low or too high. This can happen when the amount of water in your body changes. The amount of water that you take in should equal the amount you lose. If something upsets this balance, you may have too little water (dehydration) or too much water (overhydration). Some medicines, vomiting, diarrhea, sweating, and liver or kidney problems can all upset your water balance.

Treatment helps you to manage the imbalance. It also involves identifying and treating what caused the imbalance.

hope it's help you plz mark as brain list

What is the difference between hurricanes,typhoons,and tropical cyclones?

Answers

the one main difference between a hurricane and a typhoon is the specific location where the storm takes place!!

typhoons and hurricanes can reach sustained winds of an averaging 74 mph.

The Plimsoll mark is placed on the side of all large commercial ships. After
reading this article and looking at the modern Plimsoll mark, why do you
think there are so many different marks for water at different levels?

Answers

the article will not so there for i can not answer this question i’m sorry
Other Questions
argumentative essay on genetically modified foodsCAN SOMEBODY HELP ME WITH DIS PLZZ DONT PUT ANYTHANG SLOW PLZZ help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks. If 2 cups makes 6 servings, how much makes 2 servings? shawtys been simping for so long.. do you think hunter-gatherers are still around today? what makes you think that? Hi, I am very stuck on questions 17 and 18. Can someone help please? Thanks In which quadrant does the point with c ordinate (4, -3) lie? Which student has the greater median test score?