How many moles are present in 10, 0 grams of sodium hydroxide (NaOH )

Answers

Answer 1

Answer:0.250 mols

Explanation:

That’s the answer I got it wrong using the guy that previously wrote that the answer is 19 mols his totally wrong don’t trust him

Answer 2

We have that Moles that  are present in 10, 0 grams of sodium hydroxide (NaOH ) is

Moles\ NaOH =0.25moles

From the question we are told

How many moles are present in 10, 0 grams of sodium hydroxide (NaOH )

Generally the equation for the  Molar mass of sodium hydroxide is

[tex](NaOH) = (22.990 + 15.9994 + 1.008) \\\\ {(NaOH)} = 40 g/mol[/tex]

Where

Mass_{NaOH}taken = 10 g.

[tex]Moles\ NaOH =\frac{(mass of NaOH taken)}{(molar mass of NaOH)}\\\\Moles\ NaOH = \frac{10}{(40}\\\\Moles\ NaOH =0.25moles[/tex]

Therefore

Moles that  are present in 10, 0 grams of sodium hydroxide (NaOH ) is

Moles\ NaOH =0.25moles

For more information on this visit

https://brainly.com/question/17756498


Related Questions

Each of the following is a density-dependent limiting factor EXCEPT:

- crowding
- predation
- competition
- disease

Answers

Answer:

predation

Explanation:

predation

I hop this answer is correct

Answer:

Disease

Explanation:

Which of the following are prokaryotic cells?

A) plants

B) fungi

C) bacteria

D) animals

E) B and C only

Answers

fungi, bacteria

If I remember right, eukaryotic means there's more than one, so I believe this answer is right

The Answer is c: bacteria

Which kind of worm is sometimes used to prevent blood clots?

planarian
leech
fluke
hookworm

Answers

Answer:

Leech

Explanation:

leeches suck our blood so when a blood clot appears they can fix it by sucking our blood so the blood does not effect.

Answer:

a leech i got it correct on edu!

Explanation:

PLEASE ANSWER ASAPP!! WILL GIVE BRAINLIEST
Match the following peer pressure tactics to the definitions. (unspoken pressure, rejection, insults, and reasoning)

Communicating verbally and nonverbally

Attempting to convince peers to alter their beliefs

Excluding or ignoring

Dressing a certain way or participating in a certain activity

Answers

Answer:

excluding or ignoring= rejection

Dressing a certain way or participating in a certain activity= unspoken pressure

Attempting to convince peers to alter their beliefs= pressure

Communicating verbally and nonverbally= insults (?)

Match each term to the appropriate description.

Answers

Answer:

Have a great day!

Explanation:

The appropriate term for each description would be ecosystem, community, population, organism, and species respectively.

Definition of ecological terms?

An ecosystem is a community of all living organisms interacting with their environment as a system.

A community is a collection of different populations of organisms.

A population is a group of organisms of the same species capable of mating.

Species are a group of organisms that is capable of breeding to produce fertile offspring.

Thus, the term for each description would be ecosystem, community, population, organism, and species respectively.

More on ecological terms can be found here: https://brainly.com/question/13046612

#SPJ2

What are the two resulting cells formed from single cell called

Answers

"Daughter cells" is the correct answerThe cell that splits is called the "parent cell" and the two cells that form are called the "daughter cells".Please let me know if I am wrong.

I neeed helppppppp

Chemical Weathering 5 facts about it

Answers

Answer:

5 Facts

Explanation:

1. When it comes to chemical weathering, it’s all about chemistry. By looking at the term “chemical weathering,” you can see that a chemical reaction causes something to break down or “weather.” That “something” is rocks and minerals.

2. In chemical weathering, rocks and minerals are reacting to acids, oxygen, carbon and water. That’s why no two rocks ever look exactly the same. It’s also the reason that we have those awesome looking caves and unique rock formations all over the world.

3. While chemical weathering creates nifty formations, the way it breaks down rocks also causes fractures in ancient structures like the Great Sphinx of Egypt. It also causes the surface to break down on gravestones.

4. Chemical weathering types can work separately, but they often work together to create landforms and break down minerals.

5.  Acid rain caused by pollution such as factory and car exhaust is another agent of chemical weathering.

What is the purpose of cellular respiration. In a short sentence

Answers

Answer:

Produce energy (in the form of ATP) for metabolic processes and muscle contraction.

Explanation:

PLZ HELP I"LL GIVE BRAINLIEST

Answers

Answer:

gotchu

Explanation:

1. His symptoms consist of difficulty walking and an abnormal gait (pattern of movement such as walking, running, etc)

2. a. one purpose of the blood test was to test his creatine kinase enzyme to see if there were any medical conditions connected to the way he was walking and why it was abnormal

b. the other purpose is to be sure that he has something wrong with his gait. If he does have a medical condition, it was best to see if he had it early on to treat it faster

3. the function of dystrophin gene connects to the cytoskeleton of a fiber which has to do with brain function; we need that to walk. For DMD, that is a condition that alters the way people walk.

4. DMD is inherited from family's genes, so he got it from his birth family probably from his dad's part of the family as DMD effects men more than women

5. It is pretty likely as this medical condition is inheritably passed on. It is likely that his grandchild will get DMD

6. To treat DMD to the best of the ability since there isnt a cure, they could participate in physical therapy and steroids

A 154-lb adult man performs a moderate level of physical activity and regularly consumes 2700 Calories a day. State whether the weight of the man will most likely decrease, increase, or remain the same. Use information from the data table to explain your answer.

The weight of the man will...
Explanation...

Answers

Answer:

Increases.

Explanation:

A 154-lb adult man regularly consumes 2700 Calories a day and performs a moderate level of physical activity, the weight of that individual increases because a 154-lb adult man needs only 2450 Calories a day and that person consumes 2700 Calories a day which is higher than their needs so these extra calories stored in their body and as a result the weight of that person increases.

the ___severs as a relay station between the hindbrain and the forebrain.
A. forebrain

B. Midbrain

C.cerebral cortex

D. hindbrain

Answers

Answer:

B. Midbrain

Explanation:

I'm pretty sure this is it.

the answer is the midbrain cuz u can cross of forebrain and hindbrain and the cerebral cortex doesn’t apply so it’s B

What is a simple diffusion?

Answers

Answer:

movement of a solute from an area of high concentration to an area of low concentration

Explanation:

please help ::( i wanna pass w good grades

Answers

Answer:

It's catabolism I think

Explanation:

Answer:

Catabolism

Explanation:

Catabolism: the breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy; destructive metabolism.

what would the chromosome to the right be called?

Answers

Answer:

The two identical chromosomes that result from DNA replication are referred to as sister chromatids. Sister chromatids are held together by proteins at a region of the chromosome called the centromere. Chromosomes undergo additional compaction at the beginning of mitosis.

Explanation:

Based on the position of centromere and length of chromosomal arms, the chromosomes are classified into 4 groups:

(1). Telocentric chromosomes.

(2). Acrocentric chromosomes.

(3). Sub-metacentric chromosomes.

(4). Metacentric chromosomes.

What is the definition for polyploidy?

Answers

containing more than two homologous sets of chromosomes.

Question 1/7 The Nile River carries sediments to the ocean. Over time, the sediments are compressed as more sediments are deposited on top of them. Which type of rock will be formed?​

Answers

Answer:

Sedimentary Rock

Explanation:

Sedimentary rocks are formed from pieces of sediments or other existing organic matter or rock.

The sedimentary rock formation process begins with weathering which involves the breakdown of the sediments into small fragments. The next process is erosion, where water like the Nile River carries them to other places -  in this case, the Ocean.

Over time, the sediments settle and become compressed as more sediments are deposited on top of them.

This leads to the formation of Sedimentary Rocks.


True or False.
A group of the same species of living things in an area is a population

Answers

Answer:

True.

Explanation:

A population is a group of organisms of the same species that live in the same area at the same time

Answer:

True!

Hope this helps.

the question are in the Picture:) Please help me :) ​

Answers

Answer:

Birds

Explanation:

1. Wings

2. Flight feathers and beak

3. For survival purposes

What are the potential advantages and disadvantages of a major shift from the hard or traditional path of energy development to the soft or visionary path?

(These were the corresponding textbook pages, if needed) Please read the following from the textbook Environmental Science:
7th Edition - Chapter 17
9th Edition - Chapter 14

Answers

Answer:

Advantages of following the soft path, the argument here is alternative sources of power such as hydropower, geothermal energy , wind energy , and photovoltaic cells must be developed. This provides a alternative source to remain in a healthy environment and also function as the society we currently live in using the hard path.  Disadvantages of following the hard path result with future generations fearing over the irreversible damage of climate change and the damage done to our atmosphere. The hard path argue that we should continue to operate in the future as we have in the past, except more efficiently. This is close to impossible and will only continue the negative effects the hard path( the path we have been following) results in. The major shift determines the outcome of this world, the futures worries or reliefs and ultimately the survival of humans.

Explanation:

Hey My Name is Chloe, and I need some Help, But if you can't it's ok,

So I need Some Facts and Topics on Land Animals, I did some research But I didn't find enough. Any Is fine

Answers

Answer: CHIMPANZEES. RECKONED to be the most-intelligent animals on the planet, chimps can manipulate the environment and their surroundings to help themselves and their community. They can work out how to use things as tools to get things done faster, and they have outsmarted people many a time.

Explanation:

Answer: Animal: Bengal tigers

Topics: Why are bengal tigers being hunted? How many bengal tigers are left in the world?  Are bengal tigers being bred in captivity.

Facts:The White Tiger is one of the rarer relatives of the big cats. Due to their white coat they are often referred to as the bleached tiger. White Tigers are in fact a subspecies of Tigers and are the pigmented variation of the Bengal Tiger, sometimes found in the wild on the Indian subcontinent.

Explanation: I would suggest looking at national geographic if you want cooler animals.

The North Pole and the South Pole are

A:Classified as tundra biomes

B: Not home to any animals

C: not classified into major biomes.

D: Part of Aquatic Ecosystems​

Answers

D part of aquatic ecosystems

Answer:

A

Explanation:

classified as tundra biomes

Pls, I need help with this! Biology Thank you :)

Answers

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

At the zoo, Anya observes that individuals of a certain kangaroo species have slightly different sizes and colors. What characteristic of populations is Anya observing?

O adaptation
O evolution
O selection
O variation

Answers

The answer is variation, because the same species can vary in color and sizes

The coronavirus attaches to a membrane protein called

Answers

Answer:

M glycoprotein..

The coronavirus attaches to a membrane protein called M glycoprotein..

How do antibiotics work? Note: you will not be given credit for simply stating “they prevent bacterial growth” or “they kill bacteria”

Answers

Antibiotics stop infections caused by bacteria, they kill it , and/or keep them from copying themselves or reproducing . antibiotic means against life, so any drugs in your body is technically an antibiotic. they attack the wall or coating surrounding the bacteria

Answer:

here's your answer

Explanation:

May this helps you..

Try to move the different parts of the body
by moving it back and forth, side to side,
rotating, and swinging.​

Answers

The given question is incomplete, however, the missing part is as follows:

body parts movement

neck _____

lower arm _______

upper arm ________

wrist __________

shoulder _________

skull _________

knee _________

hipbone _________

elbow _________

ankle _________​

Answer:

The correct answer is given as follows:

Explanation:

A. side to side

B. swinging

C. rotating

D. rotating

E. rotating

F. back and forth

G. swinging

H. side to side

I. back and forth

J. rotating

What do coal deposits tell you about the continents?

Answers

Answer:

Coal deposits are found in sedimentary rock basins, where they appear as successive layers, or seams, sandwiched between strata of sandstone and shale.

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

A student uses a marble simulation to illustrate genetic drift. She starts with a
population of 50 individuals, represented by 25 red marbles and 25 blue marbles.
The red marbles represent an allele for pointed ears ih mice, and blue marbles
represent an allele for rounded ears. Which statement below is true?
The allelic frequency for rounded ears is 25.
The allelic frequency for pointed ears is 75 (75%).
The allelic frequency for rounded ears is 1.0.
The allelic frequency for pointed ears is 0.5 (50%).

Answers

Answer:

The allelic frequency for pointed ears is 0.5 (50%).

Explanation:

The frequency of alleles in a population must add up to 1 (100%).

The allelic frequency for pointed ears is 0.5 (50%).

What is allelic frequency ?

The allele frequency represents the incidence of a gene variant in a population. Alleles are variant forms of a gene that are located at the same position, or genetic locus, on a chromosome.

What is the difference between gene frequency and allele frequency?

Gene frequency, which more or less refers to the allele frequency, is the measurement where the number of repeats of the same allele is measured over a certain period of time.

To learn more about allelic frequency , here

https://brainly.com/question/23362399?referrer=searchResults

#SPJ2

The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation

Answers

Answer:

I am pretty sure that the answer is C.

Hopes this helps.

Have a great day!!!!!!!

It is fermentation... bc it’s the total number
Other Questions
The top missing part of the screenshot says : Every year, a dog sled race is held in Alaska and is approximately 1,150 miles in distance. Information about the top three racers is listed below. Expresa si estas o no de acuerdo con la frase: Una imagen vale ms que mil palabras. Justifica tu respuesta In the figure below, o ll g. Find the values of x and z. (42 - 16 1 84 Use the Distributive Property to solve the equation.2(6a + 9) = 16.8326a +2.9316.83a(Simplify your answers.) Read this sentence from paragraph 2 of Keep Bikes Out of 100 Oaks ParkThis kind of experience simply wont be possible if people traveling on foot need to constantly look over their shoulders for mountain bikes whizzing down hills or zooming around corners. Which phrase best describes what the author means by look over their shoulders?O move off to the sideO anticipate what is aheadO have great interestO watch for danger or threats help plzz 10 pointsWhat did Texas do to encourage railroad construction in the state? Ranchers had to develop new cattle trailsRanchers were able to ship their cattle to market by rail efficientlythe cost of getting cattle to market skyrocketed What is 25% of 160?Instructions100 of 100 words remainingBUI EEE Tvb. What is 39 of 2007Instructions100 wattDone and Review2021 Select the correct answer. Where does Internal conflict take place in a literary work? OA. in a character's home B. between any two characters OC. In a character's mind OD. In a character's neighborhood O E between the hero and the villain HELP I WILL MARK AS BRAINIESTIs this correct? Fill in the blank with the correct past participle of the verb in parenthesis.Elle m'a ____ Claire, mais je m'appelle Sophie.appelappeleappelsappeles Which Amendment protects your rights not toa practice a religion? Can you form a triangle with these given side lengths? 5 , 5 , 5PLEASE HELP ME!!! the area of a rectangle is 18cm square. what coul it dimension be? I will mark you brainiest if you can answer this Although its presence was suspected as early as 1926, the worldwide occurrence of the asthenosphere was confirmed by analyses of seismic waves from the Great Chilean earthquake of May 22, 1960. Which of these statements is NOT correct. Drugs affect your _____.for drivers ed btw :) Pls help if your good at English ill mark brainliest What is x. pls help me evaluate 4a + b2 for a = 4 b=3 I WILL GIVE AWAY THE CROWN TO WHOEVER IS CORRECT Which equation can be used to calculate the area of the shaded triangle below?A rectangle with length of 10 feet and width 6 feet. A diagonal cuts the rectangle into two halves. One of the triangular halves is shaded. A. 2(10 + 6) = 32 B. fraction 1 over 2(10 + 6) = 8 C. fraction 1 over 2(10 6) = 30 D. 2(10 6) = 120