How many grams of NaOH would be required to make 1.0 L of a 1.5 M solution

Answers

Answer 1
60 grams are required.

Hope this helped you!

Related Questions

what is the effect of light on valence electrons?

Answers

Answer:

When a small amount of external energy in the form of light is applied to the conductor, the valence electrons gain enough energy from the light to break the bonding with the atom and they jumps into the conduction band.

The effect of light on valence bis absent negative charges in the valence band, correspond to electrons elevated to the conduction band. When the semiconductor is lit, current flow is increased by both electrons and holes.

Why are valence electrons important?

The outermost or valence shell electrons, known as valence electrons, are crucial because they shed light on an element's chemical characteristics and are the ones that are acquired, lost, or shared during a chemical reaction.

In general, when an atom's outermost electron shell is full, it is at its most stable and least reactive.

Thus, The valence electrons get enough energy from the light to break their link with the atom and move into the conduction band when a modest amount of external energy in the form of light is delivered to the conductor.

To learn more about the valence electron, follow the link;

https://brainly.com/question/28977387

#SPJ2

What organelle is sac like and stores different materials?
Group of answer choices

endoplasmic reticulum

vacuoles

ribosomes

Golgi Body

Answers

The vacuoles store different materials in the cell.

A B C D ............​

Answers

Answer:

I think gamma, I'm not sure tho

This is hard, isn't it? please help me though. PLEASE

Answers

i think it might be A. i am not totally sure though

What is electrolysis

Answers

Answer:

Electrolysis is the process by which ionic substances are decomposed (broken down) into simpler substances when an electric current is passed through them. Electricity is the flow of electrons or ions.

Explanation:

hope it helped:)))))

Which one of the following to all methods of heat transfer require?

a. A difference in thermal energy

b. A liquid or gaseous state

c. Direct physical contact

d. The movement of particles

Answers

Answer:

A

Explanation:

A difference in thermal energy

The study of chemicals is called chemistry.

The correct answer is A.

According to the law of thermodynamics, It states that heat transfers from the high temperature to the low temperature.

According to the question, heat transfer must require the temperature difference between the two systems and allow to flow from high temperature to low temperature.

Hence, the correct answer is A  that is a difference in thermal energy

For more information, refer to the link:-

https://brainly.com/question/14698383

Which element has chemical properties most similar to carbon (C)?
A. Lithium
B. Silicon
C. Titanium
D. Neon

Answers

The answer is B the silicon

Answer:

b

Explanation:

Silicon has the chemical properties that are most similar to those of carbon

What are the [H+] and [OH-] for a substance with a pH of 9.2? Show work please

Answers

Explanation:

[H+]=10^-pH

[H+]=10^-9.2

[H+]=6.031x10^-10

[OH-]=1x10^-14÷[H+]

[OH-]=1x10^-14÷[6.031x10^-10]

[OH-]= 1.66x10^-5

im pretty sure this is right

When determining an Empirical formula

a)you must change everything to percentages

b)you must use Avogadro's number

c)you must convert grams to moles

d)you must balance the equation

Answers

The answer is d I think. Hope it helps good luck.☺️

How do changes to genes in body cells differ from changes to genes in egg and sperm cells?

Answers

Answer:

These genetic changes are not present in a parent's egg or sperm cells, or in the fertilized egg, but happen a bit later when the embryo includes several cells. As all the cells divide during growth and development, cells that arise from the cell with the altered gene will have the mutation, while other cells will not.

Explanation:

Drag each item to show if it is matter or not matter.

light bulb added to
sunlight


heat


lamp


matter

light bulb


not matter

Answers

Only physical things have matter


Most of Earth's atmosphere is made up of nitrogen gas. Nitrogen can also
exist as a solid, liquid, or plasma. Four samples of nitrogen are each in a
different state but have the same mass. Which statement about the relative
amounts of thermal energy in the samples is true?

Answers

Answer:

it should be B (i did this wrk before)

Explanation:

In the Haber reaction shown below, _______?is the
limiting reactant if equal moles of each reactant are used.
3H2 + N2 -> 2NH3

Answers

Answer: hydrogen

Explanation:

The following symbol (<-->) means

Answers

Answer:

Greater than or less than

help..................

Answers

Answer:

Volcanic eruption

Explanation:

a crater is this bowl shaped hole in the ground, and it is caused by a meteorite or volcanic activity

Name the 6 kinetic factors

Answers

Kinetics is the study of reaction rates and how they are affected. Many factors, such as concentration, pressure, temperature, and enzyme activity, can impact the rate of a reaction.

12) Balance the following chemical equation:
Zn +
H3PO4
Zn3(PO4)2 +
H2

Answers

Answer:

Sorry I am not very good at chemistry.

Explanation:

How many moles of NaCl are contained in 100.0 mL of a 0.20 M solution?​

Answers

Answer:

0.02 mol.

Explanation:

Please help fast. I will give brainliest!

Answers

Answer:

c=-1+x=varible+a=(5)^3

Explanation:

facts

Find the mass of 1.59 mol of NH3.
Please show the work if you can!

Answers

Answer:

25.4/km=3

Explanation:

If the initial rate of H2 to disappear is 2.0 moles per second, what is the rate of appearance of NH3 at the same time? N2(g) 3 H2(g) ⇌ 2 NH3(g)

Answers

Answer:

1.33 moles per second

Explanation:

From the balanced equation of reaction, 3 moles of H2(g) need to disappear/be consumed before 2 moles of NH3(g) can be formed/appear.

According to reaction law, the rate of disappearance of reactants is equal to the rate of appearance of products.

Now, only 2 moles per seconds of H2 has disappeared initially;

3 moles H2 is needed for 2 moles NH3

2 moles H2 will give;        2 x 2/3 = 4/3 or 1.33 moles

Hence, if the initial rate of disappearance of H2 is 2.0 moles per second, the initial rate of appearance of NH3 would be 1.33 moles per second.

7. Where do amino acids reside ?

Answers

Answer:

Explanation:

Polar side chains tend to be present on the surface of a protein where they can interact with the aqueous environment found in cells. On the other hand, non-polar amino acids tend to reside within the center of the protein where they can interact with similar non-polar neighbors.

A H2CO3 (aq) ---> CO2 (g) + H2O (l) B H2SO4 (aq) + 2NaOH (aq) ---> Na2SO4 (aq) + 2H2O (l) C 2H2 (g) + O2 (g)----> 2H2O (l) D AgNO3 (aq) + NaOH (aq) ---> AgOH (s) + NaNO3 (aq) Which equation above represents a precipitation reaction?

Answers

Answer: [tex]AgNO_3(aq)+NaOH(aq)\rightarrow AgOH(s)+NaNO_3(aq)[/tex]

Explanation:

A double displacement reaction is one in which exchange of ions take place. The salts which are soluble in water are designated by symbol (aq) and those which are insoluble in water and remain in solid form are represented by (s) after their chemical formulas.  

A double displacement reaction in which one of the product is formed as a solid is called as precipitation reaction.  

The equation which represents a precipiation reaction is:

[tex]AgNO_3(aq)+NaOH(aq)\rightarrow AgOH(s)+NaNO_3(aq)[/tex]

50 points if its right In the Northern Hemisphere, choose ALL that apply

Question 2 options:

Summer solstice occurs when the Earth's North Pole is tilted toward the sun.


Fall and Spring Equinoxes occur when days and nights are equal in length.


The tilt and revolution of the Earth causes the seasons


Winter solstice occurs when the Earth's North Pole is tilted away from the sun.

Answers

Answer:

All are correct

Explanation:

I took the test

Answer: pick all

Explanation:

i got 100% on my qiuz

What is the correct IUPAC name for the acid: H2Lv

Answers

Hydrogen chalcogenides

which type of window is double glazed window​

Answers

Answer:

Hope this helps and have a good day!

Explanation:

Double glazed is a fancy term for a window that has two panes of glass. There are also triple glazed windows (three panes). The multiple panes of glass in a single window frame helps with insulation.

Can somebody help please

Answers

Answer:

98 moles of H₂O.

Explanation:

We'll begin by writing the balanced equation for the reaction. This is illustrated below:

2HCl + CaCO₃ —> CaCl₂ + H₂O + CO₂

From the balanced equation above,

1 mole of CaCO₃ reacted to produce 1 mole of H₂O.

Finally, we shall determine the number of mole of H₂O produced by the reaction of 98 moles of CaCO₃. This can be obtained as follow:

From the balanced equation above,

1 mole of CaCO₃ reacted to produce 1 mole of H₂O.

Therefore, 98 moles of CaCO₃ will also react to produce 98 moles of H₂O.

Thus, 98 moles of H₂O were obtained from the reaction.

30 points please help

Answers

Answer:

its D I'm pretty sure because it's from high heat/pressure

The sound of a trumpet ECHOES off a nearby mountain. This is which type of wave interaction?

Answers

Answer:

reflection

Explanation:

wave reflection is when a sound bounces off something it cannot go through, like echoing

UGRENT! Please help showing all work

Answers

Answer:

a. Oxygen

b. 2.62 g of NO

c. 85.2%

Explanation:

Let's see the presented reaction:

4NH₃ + 5O₂  →  4NO  +  6H₂O

4 moles of ammonia react to 5 moles of oyxgen in order to produce 4 moles of NO and 6 moles of water.

To determine limting reagent, we need moles of each reactant. Let's calculate them:

3.25 g /17 g/mol = 0.191 moles

3.50 g /32 g/mol = 0.109 moles

4 moles of amonia react to 5 moles of oxygen

Then, 0.191 moles will react to (0.191 . 5) / 4 = 0.238 moles

We only have 0.109 moles available and we need 0.238, so the oxygen is the limting reactant.

5 moles of O₂ can produce 4 moles of NO

So, our 0.109 moles will produce (0.109 . 4) /5 = 0.0872 moles

We convert the moles to mass: 0.0872mol . 30g/mol = 2.62g

(Yield produced / Theoretical yield)  . 100 = %

(2.23g / 2.62g) . 100 = 85.2%

Other Questions
What role does Janes ambiguous social position play in determining the conflict of her story? (its based on the book Jane eyre)I need this ASAP! DQuestion 2If a right triangle has side lengths 6, 6.7 and 3, which side is the hypotenuse?O 3O 6.7O 15.706 What characteristics do Percy and his mother have in common? How do they differ? Plz help me!Plz well mark brainliest if correct! distace x time graph will be ................ if the body is in ununiform motion Was there a contradiction between Balfours proposal to establish a national home for the Jewish people and the promise that nothing shall be done which may prejudice the civil and religious rights of existing non-Jewish communities in Palestine? If so, why did he make two contradictory promises? argumentative essay on genetically modified foodsCAN SOMEBODY HELP ME WITH DIS PLZZ DONT PUT ANYTHANG SLOW PLZZ help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks.