how does pollution travel from a river to the ocean?

a) pollution flows upstream toward the ocean

b) pollution flows downstream toward the ocean

c) pollution flows toward the bank of a river and then to the ocean

d) pollution flows toward the source of a river

How Does Pollution Travel From A River To The Ocean?a) Pollution Flows Upstream Toward The Ocean B) Pollution

Answers

Answer 1

Answer:

d

Explanation:

Answer 2
I would say d, because the other guy said d

Related Questions

1. In the diagram, the arrow #9 is pointing to an organelle called





mitochondria
nucleus
smooth endoplasmic recticulum
endoplasmic recticulum

Answers

Answer:

Mitochondria

Explanation:

In rabbits, spotted coat (S) is dominant to solid color (s) and black (B) is dominant to brown (b). A true-breeding black spotted rabbit is mated to a true-breeding brown solid rabbit to produce a heterozygous F1 generation. Two F1 individuals are mated, and you do not see a 9:3:3:1 (black spotted: black solid: brown spotted: brown solid) ratio of offspring, but instead see that almost all offspring are a non-recombinant phenotype. This tells you that

Answers

Answer:

Epistasis effect result into these offspring

Explanation:

Given

spotted coat (S) is dominant to solid color (s) and black (B) is dominant to brown (b)

Genotype of true-breeding black spotted rabbit BBSS

Genotype of  true-breeding brown solid rabbit bbss

Genotype of offspring BbSs

In normal crossing between BbSs and BbSs offspring of F1, should produce offspring in the ratio 9:3:3:1

But it does not happens in this case the simple reason could be  presence of Epistasis in which the alleles assort independently but do not express themselves because of the following reasons -

a) Interaction between two or more loci thereby resulting into new phenotypes

b) An allele at one locus masks effects of other allele at one or more loci

c) Allele at one locus modifies the effects of alleles at one or more other loci

Examine the Punnett square below. A cross between the two parents results in 50 offspring. How many of the offspring are most likely to have the dominant trait?

Answers

From what I know a punnet square like that gives a 75 percent chance of the dominant trait to that offspring. I’m not entirely good at the subject but I hope that helps?
75 % ........................


Which term best describes the joints at the top of your
skull?

A.) Motionless
B.) Flexible
C.) Rubbery
D.) Elastic

Answers

Answer: A

Explanation:

the joints on the top of your skull is motionless

Plant cells are different from animal cells. The diagram below identifies four different structures in a plant cell. Compared to the structures in an animal cell, which of the following structures is found only in a plant cell?

a. Mitochondrion
b. Cell Wall
c. Cytoplasm
d. Nucleus

Answers

B.cell wall , hope this helps
The cell wall is only found in a plant cell

Please help i am giving away brainiliest

Describe the Lytic cycle.

No dam links

Answers

Answer:

Ok here ya go

Explanation:

The lytic cycle is one of the two cycles of viral reproduction, the other being the lysogenic cycle. The lytic cycle results in the destruction of the infected cell and its membrane. Now during the lytic cycle of virulent phage, the bacteriophage takes over the cell, reproduces new phages, and destroys the cell. T-even phage is a good example of a well-characterized class of virulent phages.

is this answer good enough? That’s all I know to my knowledge

can you please answer these questions for me I really need help I am begging you

Answers

Answer:

1: 75%

2: 75%

3: 50%

4: 25%

I NEEEEEDDDD HELP PLEASE

Answers

Answer:

Proteins.

Explanation:

Genes contain instructions to  assemble amino acids in proteins.

PLEASE HELP


The theory of plate tectonics is supported by evidence that crustal plates move relative to each other. How does this observation support the theory of plate tectonics?
It suggests that plates are dragged around by ocean currents.
It suggests that plates are dragged around by air currents.
It suggests that plates can move independently of one another.
It suggests that plates cannot move independently of one another.

Answers

Answer:

Its c the third answer

Explanation:

Our atmosphere is composed of several gases. The name of the gas we breathe, O2, is A) oxygen squared B) monoxide. C) oxide. D) diatomic oxygen.

Answers

A. Oxygen Is the most abundant

How are animals in the polar dying connected to climate change?
help

Answers

Answer: well, ce dependent species such as narwhals, polar bears, and walruses are at increasing risk with shrinking sea ice cover. ... As the Arctic loses snow and ice, bare rock and water absorb more and more of the sun's energy, making it even warmer. This is called the albedo effect.

Explanation:

Sunlight allows producers and the animals that depend on them to live in the ______ zone.
A.abyssal
B.neuritic
C.bathyal
D.intertidal

Answers

The answer is bathyal

Answer: B. Neuritic zone

What fossil is evidence that animals moved from living in the water to dry land? If u could help thanks!

Answers

Answer:

Tiktaalik roseae

Explanation:

The discovery of the fossil, Tiktaalik roseae on a Canadian island gives credence to the fact that animals moved from living in water to living on dry land. This fish which has feature of land animals such as a neck, skull, and ribs is believed to have lived some 375 million years ago. It also has features of fish such as the fins and scales.

The discovery of this fossil is important to scientists because it confirmed their believe that there should be an organism that would prove that life transitioned from water to land. The fossil was discovered in the year 2004.

. A _____________________________________________ key is used to determine the identity of an organism

Answers

Answer: A dichotomous key is a tool that allows the user to determine the identity of items and organisms in the natural world. It is the most widely used form of classification in the biological sciences because it offers the user a quick and easy way of identifying unknown organisms.

Explanation:

which problem do you think contributes most to water scarcity?

Answers

Answer:

Agriculture consumes more water than any other source and wastes much of that through inefficiencies. Climate change is altering patterns of weather and water around the world, causing shortages and droughts in some areas and floods in others. At the current consumption rate, this situation will only get worse.

-WWF

What are some things you think would help identify a fossil? *

Answers

Answer: by studying the Fossil record we can tell how long life has existed on earth,and how different plants and animals are related to each other.often we can work out how and where they lived, and use this information to find out about ancient environments fossils can tell us about a lot about the past.

Explanation: If you like it please mark brainlest....

What is true about one strand of DNA?


It contains many chromosomes.


It contains many proteins.


It contains many pieces of RNA.


It contains many genes.

Answers

Answer:

it contains many genes.

Answer:

D: It contains many genes

Native vegetation determines the _________________________ and _________________________ of organic matter in the soil.

Answers

Answer:

Explanation:

Texture

Why don't individuals with Tay-Sachs pass on the Tay-Sachs
allele?
a
Tay-Sachs disease is a recessive human genetic
disorder.
b Carriers are not affected.
c Affected individuals do not have children.

Answers

Answer:

Affected individuals do not have children.

Explanation:

Tell me if you think caecilians are amphibians, reptiles, or fish.

Answers

Answer:

Amphibians

Explanation:

Which of the following correctly describes how DNA contributes to the traits that appear in offspring? A) DNA contains the instructions for building RNA, which influences traits. B) DNA contains the instructions for building proteins, which create the physical traits of offspring. C) DNA contains the instructions for building carbohydrates, which are responsible for the physical traits of offspring. D) DNA contains the instructions for building enzymes, which catalyze chemical reactions for the traits of offspring.

Answers

a dna contains the instructions

DNA attributes to the genotype preference to the individual.  DNA contains the instructions for building RNA, which influences traits. The correct statement is answer A.

What is the full form of DNA ?

DNA stands for deoxyribonucleic acid.

DNA contains the orders that are needed for any organism in order  to develop, survive as well as reproduce. To carry out these duties, DNA sequences are needed to be converted into messages which can be used to produce proteins in  which are the complex molecules that are  doing  most of work in our body.

Since we have two pairs of chromosomes and we also have two pairs of genes in which  one  is from our father and one is  from mother. These pairs of genes then determine certain physical features or traits.

Learn more about DNA at :

https://brainly.com/question/264225

#SPJ2

Sound waves move the slowest through which medium? water ice air wood

Answers

Answer: The answer is the following.

the question is: sound waves move through which medium?

a. water

b. ice

c. air

d. wood

the best answer to this question would be c. air. <3

Explanation:

The Speed of Sound: Sound travels at different speeds depending on what it is traveling through. Of the three mediums (gas, liquid, and solid) sound waves travel the slowest through gases, faster through liquids, and fastest through solids. Air is a gas so therefore, C. AIR IS THE CORRECT ANSWER :)

The sound waves move the slowest through which medium:

C.Air

The sound waves move the slowest through which medium is air. Sound travels at different speeds depending on what it is traveling through. Of the three mediums (gas, liquid, and solid) sound waves travel the slowest through gases, faster through liquids, and fastest through solids.

Therefore, the correct option is C.

Know more :

https://brainly.com/question/14405871?referrer=searchResults

How does type 1 diabetes affect the cardiovascular system?

Answers

Answer:

diabetes can damage your blood vessels and the nerves that control your heart and blood vessels, causing to have a bad affect on your cardiovascular system.

Those individuals that are better able to survive in the Environment tend to be:

Answers

Answer:

Fit

Explanation:

They are the ones who are strong enough to survive.

Someone PLEASE HELP!!!

Answers

Answer:

Autosomal Recessive

Explanation:

The method of inheritance is autosomal recessive. Notice how the disease skips the parent generation. This indicates that parents have the recessive allele but do not express the trait. The individuals who are shaded in have two recessive alleles that were passed on from their parents, therefore they have the disorder.

in dogs, being clumsy (C) is dominant to being cool (c) and being dazzling (D) is dominant to being docile (d)

Answers

Answer:

i didnt know that..!

Explanation:

Answer:

9/16

Explanation:

CcxCc = CC, Cc, Cc, cc (3/4)

DdxDd = DD, Dd, Dd, dd (3/4)

3/4 x 3/4 = 9/16

Write short note on consumer.

Answers

Answer:

i don't know ajisjdbehanjakdiodjebfbnakoy

okkkkkkkkkkkkkkkkkkkkkkkkkkkk

List 4 chordate characteristics.

Answers

Answer:

notochord, dorsal hollow nerve cord, pharyngeal slits, and a post-an4l tail

Explanation:

had to censor second to last word but the 4 is an a

What are some physical properties of the sun?

Answers

Answer:

Mass: 1.98892 x 1030 kg.

Diameter: 1,391,000 kilometers.

Radius: 695,500 km.

Surface gravity of the Sun: 27.94 g.

Volume of the Sun: 1.412 x 1018 km3

Density of the Sun: 1.622 x 105 kg/m3

Explanation:

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

Other Questions
5th Grade U.S Studies Weekly- Week 24 Answer Key(Please create one)Topic: Hardships of WarFt. Abigail Smith AdamsFt. Mercy Otis WarrenFt. Martha Dandridge Custis WashingtonFt. Molly PitcherFt. Phillis Wheatley American PoetFt. Sybil LudingtonQ: to collect and hide food our suppliesA: __________________________Q: Robert Shurtleff's real first nameA: __________________________Q: general who thanked Sybil Ludington for her braveryA: __________________________Q: raising of prices over a period of timeA: (Is this answer, inflation?) _________Q: wrote politically plays and poetryA: __________________________Q: someone who raises prices on goods that are scarceA: __________________________Q: plantation ownerA: __________________________Q: Congress raised money by selling debt _____A: __________________________Q: took her husband's place in battleA: __________________________Thank you so much! You are so well appreciated. I'll offer you brainliest. Please leave a comment if you'd like brainliest. THANK YOU!!! Subjective: 6-year-old girl twisted her arm on the playground. She is seen in the ED complaining of pain in her wrist. Objective: Vital Signs: stable. Wrist: Significant tenderness laterally. X-ray is normal Assessment: Wrist sprain Plan: Over the counter Anaprox. Give twice daily with hot packs. Recheck if no improvement. What is the E/M code for this visit 5.Convert each of the following fractions to a decimal using long division.1332A.B.08 What was the most significant achievement of Piankhi's rule? BRAINLIESTWhich expression is equivalent to(-80 + 2) - (62 +9)? 0 21 7 0 21 +11 0 141 7 O 14z +11 Margo thinks Patrick hates her dog. Every time he comes to her house, he doesn't pet her dog. Is Margo making a reasonable argument? Yes, if he won't pet her dog that means he hates it Yes, living proof is always the best evidence No, she does not have enough evidence No, maybe Patrick does not like any pets, even cats Num cinema, h 12 fileiras com 16 poltronas e 15 fileiras com 18 poltronas. O nmero total de poltronas In a paragraph of 35 sentences, explain Lyndon B. Johnson's "War on Poverty," and describe key programs in the plan, which included housing programs, jobs programs, and social safety net benefits. What does the word scale mean in this sentence? Which of these BEST describes how 1957 was a "turning point" in American and world history? A bag contains 3 red marbles(R), 5 green marbles(G), 2 black marbles(B), and 1 white marble(W). A marble is drawn from the bag and then replaced 30 times. What is the experimental probability of drawing a red marble Can someone please help me find the area. What is the area 38cm 16cm 20cm 18cm Lydia is an architect. She has to design a courtyard garden inside a new hotel. On her blueprint, which is 1/24 the size of the actual garden, the width of the garden is 31 inches. What is the width of the actual garden? A. 744 inches B. 552 inches C. 806 inches D. 1,200 inches Systems of Equations Word Problems25. A system of equations is given. 1/3x+2y=-1y=2/3x-3What is the x-value of the solution to the system of equations?Enter your answer in the box. Compltez la phrase en choisissant la bonne forme du verbe et le vtement qui correspondent le mieux la situation.Quand il pleut, jetoujours please help i will give brainliest! PLEASE HELP, ANSWERS IN THE DROPDOWN ARE RHE SAME FOR ALL THE OTHERS A marble was sent down a ramp into a solo cup. The first time the solo cup moved 20 cm. The second time the solo cup moved 24 cm. The third time the cup moved 16 cm. What is the average movement of the cup? Read the excerpt from Silent Spring.There was once a town in the heart of America where all life seemed to live in harmony with its surroundings. The town lay in the midst of a checkerboard of prosperous farms, with fields of grain and hillsides of orchards where, in spring, white clouds of bloom drifted above the green fields. In autumn, oak and maple and birch set up a blaze of color that flamed and flickered across a backdrop of pines.Which phrases in the excerpt best support the authors purpose of creating a positive image of a town? Select five options.heart of Americalive in harmonywith its surroundingslay in the midsthillsides of orchardsin autumnblaze of colorbackdrop of pines'WILL GIVE BRAINLYEST