How did suburbs like Levittown contribute to racial discrimination?

Answers

Answer 1
Don’t download the links that people put its a virus i think but...
Suburbs like Levittown Contributed to racial discrimination by Discriminating against black people. Black people were prohibited to live in the Levittown community.

Related Questions

Help my lil bro plssss
What do financail industries charge people who borrow money?
Checking Account Fee
Intrest Fee
Lender's Fee
Repair Charge

Answers

what do u mean can u explain more

Answer:

Interest Fee

Explanation:

I believe this is the right answer

How far did the Aztec empire extend from north to south?

Answers

Answer:

It extended 80,000 sq miles.

Explanation:

The realm stretched out 80,000 sq miles from parts that are now known as central and southern Mexico. The Aztec empire reached out from the Pacific Ocean to the Gulf Coast and from Central Mexico and what we now know as Republic of Guatemala.

What is the main idea and 3 details that support the main idea of this passage.
If its blurry read here...
"During the Middle Ages, the people of Europe began to unite due to common ground,most nobalty religion. Christianity held the countries and continent together, and since religion was a powerful bond, the Catholic Church, and especially the pope had great power. He was viewed as God's representative on Earth. This position made whoever held the office responsible not only for the spiritual well-being of the people, but also for issuing bulls, writings on moral and spiritual teachings or church policy, for the rest of Europe to live by. When Europe fell apart after the fall of Rome in ancient Europe, the Pope was looked to for reassurance and leadership. The pope's power also lent them to political stances, and thus significant wealth. Many popes built palaces to live in, wore the finest clothes, and ate and drank choice foods and wine.Later in Feudal European history, the pope often disagreed with kings of various countries, due to moral or spiritual issues. If the king refused to do what the pope saw as right, the pope could excommunicate him, meaning the king was removed from the church. Many Christians feared this verdict because it implied that the ruler wouldn't go to heaven at the end of his life."

Answers

Answer:a

Explanation:

What aspect of the Columbian Exchange changed the lives of American Indians the most?

Answers

Answer:

One of the first European exports to the Americas, the horse, changed the lives of many Native American tribes. The mountain tribes shifted to a nomadic lifestyle, based on hunting bison on horseback.

Explanation:

sorry if i'm wrong

Sort the following features by the document they apply to.
declared national laws to be more powerful than state
laws
forbade states from printing or coining money
did not allow Congress to regulate foreign trade or trade
between states
allowed Congress to tax imports and exports
funded Congress through voluntary contributions from
the states
allowed states to print and coin money
The Articles of Confederation
The Constitution

Answers

Answer:

The need for a stronger Federal government soon became apparent and eventually led to the Constitutional Convention in 1787. The present United States Constitution replaced the Articles of Confederation on March 4, 1789.

Question
What biome is characteristic of Central Sub Saharan Africa nearest the equator?

A. Tundra


B. Desert

C. Savanna

D. Tropical Rainforest

Answers

Answer:

I think the answer is D, tropical rainforests.

The biome that is in the Central part of Africa and located nearest to the Equator is the D. Tropical Rainforest.

The Tropical Rainforest:

Is the biome nearest to the Equator. Forms as a result of the constant sunlight on the Equator.

The Equator passes through the Central Sub-Saharan Africa which is why the Tropical Rainforest has formed there. This region sees a lot of deforestation however.

In conclusion, option D is correct.

Find out more on the Topical Rainforest at https://brainly.com/question/3096110.

Why do you think this period is considered a golden age in Chinese history? Write one or two paragraphs explaining how the Tang and the Song dynasties — and their leaders — made it possible for people to accomplish so much.

Answers

give answer phrase kari

A savings bond functions most like which of the following?

A bill for a service like electricity, which is paid to the provider every month
A loan to any government agency, which is repaid on an installment plan
A loan to the federal government, which is repaid to the creditor with interest
An individual credit card debt, which is never repaid and keeps earning interest

Answers

Answer:

Your answer would be B, A loan to any government agency, which is repaid on an installment plan.

Explanation:

HOPE THIS HELPS!! :)

A savings bond functions most like a loan to any government agency, which is repaid on an installment plan, Thus, option (b) is correct.

What is saving bond?

Savings bonds operate through the payment of interest and the compounding of interest. A savings bond can accrue interest, but it is not paid out until the bond is redeemed.

Governments and businesses both issue bonds as a means of raising capital. In exchange, they pledge to repay you the face amount of the loan on a particular date and to pay you interest on the bond at regular intervals.

As a result, option (b) is correct.

Learn more about on savings bond, here;

https://brainly.com/question/16653130

#SPJ2

In which of the countries listed on the chart above would you expect the standard of living in urban areas to be the lowest?
A.
Thailand
B.
India
C.
Cambodia
D.
Bangladesh

Answers

I would say the answer is A. Thailand
We just had a question similar to this the answer is defintly A!

Manifest Destiny is what Americans believed in the 1800s. What were Americans destined to do?
1.)Acquire more Slaves
2.)Take over the continent
3.)Search for Gold

Answers

Answer:

2

Explanation:

i think it is 2 cause I guessed

3 i think ! i hope this was right

What is profit??

thank you! :)

Answers

Answer:

Profit is when you complete a task or work for something and you make earnings back such as money.

Give me a specific example of how supply and demand affect prices in the real world.

Answers

Answer:

Supply and demand rise and fall until an equilibrium price is reached.

Explanation:

For example, suppose a luxury car company sets the price of its new car model at $200,000. While the initial demand may be high, most consumers are not willing to spend $200,000 for an auto.

Hope this helped you!

Answer:

Supply and Demand affect prices in the real world because in the real world people can demand supplies so they can buy them and the more of the demand the more expensive the supply is. For example Russia can demand more toilet paper from America while the prices benefit America because they are the ones getting paid.

Explanation:

What types of expenses should you include when creating a budget? plz hurry

Answers

Answer: Food expenses, gas, mortgage, pretty much anything that you pay for.

Fuel, chef fees, ingredients, crockery

3. Which word in this article has more than three syllables?

A. astronauts

B. telescopes

C. nutritional

D. vitamins

Answers

Answer:

C. nutritional

Explanation:

nu-tri-tion-al has 4 syllables.

I’m pretty sure it is B. Telescopes

What is the main idea and 3 details that support the main idea of this passage.

If its blurry read here...
"During the Middle Ages, the people of Europe began to unite due to common ground,most nobalty religion. Christianity held the countries and continent together, and since religion was a powerful bond, the Catholic Church, and especially the pope had great power. He was viewed as God's representative on Earth. This position made whoever held the office responsible not only for the spiritual well-being of the people, but also for issuing bulls, writings on moral and spiritual teachings or church policy, for the rest of Europe to live by. When Europe fell apart after the fall of Rome in ancient Europe, the Pope was looked to for reassurance and leadership. The pope's power also lent them to political stances, and thus significant wealth. Many popes built palaces to live in, wore the finest clothes, and ate and drank choice foods and wine.Later in Feudal European history, the pope often disagreed with kings of various countries, due to moral or spiritual issues. If the king refused to do what the pope saw as right, the pope could excommunicate him, meaning the king was removed from the church. Many Christians feared this verdict because it implied that the ruler wouldn't go to heaven at the end of his life."

Answers

Answer: The main idea is during the middle ages the people of Europe began to unite due to them having a common ground of religion.

1. When Europe fell apart after the fall of Rome in ancient Europe, the Pope was looked to for reassurance and leadership.

2. Christianity held the countries and continent together, and since religion was a powerful bond, the Catholic Church, and especially the pope had great power.

3.Whoever held the office responsible not only for the spiritual well-being of the people, but also for issuing bulls, writings on moral and spiritual teachings or church policy, for the rest of Europe to live by.

Explanation: Just read the passage and you'll see i'm right.

Which is an example of a secondary source?
A: Diary
B: Letter
C: Interview
D: Article

Answers

Answer:

D. Article

(if you mean secondary source to know what happened in history)

an example of secondary source is D

How many years passed between the annexation of Texas and the purchase of Alaska?

Answers

22 years have passed :)

Answer:

22 years

Explanation:

hope this helps!

What is the answer to #1?

Answers

The answer is A cuz the picture looks lik El Salvador

HELP ASAP CORRECTLY!!!
write your opinion as far as wether you think judges should be allowed to hand down sentences based on the characteristics of individual cases and defendants, or should they follow mandatory sentencing guidelines. (1 paragraph at least)

Answers

Answer:

I think judges should follow mandatory sentencing guidelines because it would be unfair to get so many sentences. If you get what i mean hopes this helps.

What achievements show that the Aztec had engineering skill?

Answers

Answer:

Their engineering achievements include the construction of a double aqueduct, a massive d i k e, causeways and artificial islands.

Explanation:

sorry if i'm wrong

What were the actions taken by Charles Hamilton Houston and Victor Hugo Green? How did each man’s actions make a difference?

Answers

Answer:

Charles Hamilton Houston was a prominent African-American lawyer, Dean of Howard University Law School, and NAACP first special counsel, or Litigation Director. A graduate of Amherst College and Harvard Law School, Houston played a significant role in dismantling Jim Crow laws, especially attacking segregation in schools and racial housing covenants. He earned the title "The Man Who Killed Jim Crow".

Explanation:

The Industrial Revolution caused hardships mainly for... *

The Landowners
The Workers
The Middle Class
The Bougresie
The Factory Owners

Answers

Answer:

land owners

Explanation:

i took a similar quiz

The answer will be landowners

The first colony in Latin America to gain freedom was Haiti. It had previously been a French colony called St. Domingue. In 1791, while the ruling class of St. Domingue was busy worrying about the French Revolution, the slaves took advantage of the squabbling and revolted. Under the leadership of Toussaint Louverture, the slaves managed to overthrow the government. In 1804, Haiti was declared a free country. Other countries also took advantage of European distraction to break free. After the French Revolution, Emperor Napoleon was stomping all over Europe. He had invaded Spain and Portugal. In Mexico in 1810, Father Miguel Hidalgo y Costilla rallied Native Americans and mestizos, or people of mixed Native American and Spanish heritage, to fight for independence. They lost, and Hidalgo was executed, but the spirit of revolution began to spread. In 1821, Mexico gained independence from Spain when a Creole named Vicente Guerrero, who had been charged with killing revolutionaries, decided to unite with them instead.

Because the ruling class of St. Domingue was busy worrying about the French Revolution,

A. Mexico gained independence.
B. Toussaint Louverture took back control of Haiti.
C. Napoleon invaded Spain and Portugal.
D. Haiti gained independence.

Answers

B. Toussaint Louverture took back control of Haiti

Which industry was the first to maximize the potential of machine power? *

Textiles
Transportation
Construction
Food Production

Answers

Answer:

Textile industry

Explanation:

They were the first to industrialize.

Hey wait to see you tomorrow I can come over and help me get my dad to come take you to school and then I can do that for Ap and I can do it that for you guys and I will come over tomorrow and I will send it to my dad tomorrow or if you need to help out please let me know what you want me please let me know thank love you guys live thank love you for the invite tomorrow

why did many northern believe that the congress should oversee reconstruction?
need help ASAP

Answers

Answer:

They wanted to do this because they wanted an end to the war, other didn't want to though, they thought that It would bring people back into slavery.

Explanation:

Hope it helps :)

they wanted to end the war

Karl Marx claimed in The Communist Manifesto that: *

Coal helped influence the Industrial Revolution.
Creating colonies around the world would lead to a wealthy, powerful nation.
The Proletariat were being oppressed by the Bourgeoisie.
Railroads would help empower the working class.

Answers

Answer:

I thin it's

: Creating colonies around the world would lead to a wealthy, powerful nation.

Explanation:

Karl Max understood the Industrial Revolution as creating an unstable system that would collapse in a revolution. His ideas had an impact in the industrializing world of the nineteenth century because they inspired socialist movements and took root in unions, and shaped his idea of communism.

PLEASE MARK BRAINLEST

Don't answer me with Yes or no or links or files as answers. For 1, it doesn't count as an answer, and 2, If you do, you will SPAM ME, which I do not like!
Which of the following is NOT a form of local government?
A. State
B. City
C. County
D. Township

Answers

The correct answer is A

Which answer BEST supports the statement, "China's government can be considered an Oligarchy"?
A) The government has traditionally existed as a command economy.
B) The only political party allowed to exist is the Communist Party of China.
C) The right to vote is given to all citizens who are at least 18 years of age.
D) The government is ruled completely by one person who has unchecked authority.

This is from USATestprep

Answers

Answer:

D) IS CORRECT BECAUSE IN OLIGARCHY GOVERNMENT, A SMALL GROUP OF PEOPLE OR AN INDIVIDUAL HAVE POWER

Explanation:

brainliest pls

d is the correct answer for your question.

What aspect of the Columbian Exchange changed the lives of American Indians the most?

Answers

Answer:

One of the first European exports to the Americas, the horse, changed the lives of many Native American tribes. The mountain tribes shifted to a nomadic lifestyle, based on hunting bison on horseback. They largely gave up settled agriculture. Horse culture was adopted gradually by Great Plains Indians.

Explanation:

What would happen if banking didn’t exist?
I really have no idea

Answers

Answer:

If banking didn't exist, The housing industry would take a major hit. People would have to save their money at home and it would be very difficult to pay bills, because you would have to take cash to the bill owner, And break ins would happen more.

Explanation:

I had to do a paper on this.

Other Questions
HELPP!!!!!!!!!!!!!!!! What transformation is shown below?reflectioncan't be determinedrotationtranslation In triangle ABC, angle A measures 50.5 degrees and angle B measures 74 degrees. What is the measure of angle C? DO NOT TRY TO PUT A DEGREE SIGN. JUST TYPE THE ANSWER!! - 1:Translate the following sequence into a short protein. Add hyphens between,please.235'- AUG GCA AAA GAG GAA CAU UAA - 3'56Second LetterUAGPheTyrSerUUUUUUCUUAUUGUCUUCCUCAUCGUAUUACUAAUAG39LeuStopStopUGUCys UUGCUGA Stop AUGG Trp GCGUCGCArgCGAGHisProCUUC | CCCUACUGCCULeu CCCCCACCGCAUCACCAACAGGin121st3rdCGGletterAsnSerlleAUUA AUCAUAAUGACUACCACAThrAAUAACAAAAAGAGUAGCAGAAGGU letterAG15Lys|ArgMet ACGAspGUUGGUCGUAGUGValAlaGCUGCCGCAGCGGAUGACGAAGAGGGUGGCGGAGGGGly|Duco18Gluhttp://biology.kenyon.edu/courses/biol114/Chap05/Chapter05.html1 Kailynn has been on a roll, and solving 5 math problems every 2.5 minutes. At this rae, how many problem will she solve in 30 minutes. What is the slope of the line in the graph? please help me with this please, this is due in a couple of minutes. Which states the best reason why Chapter 15 might be titled "Nest-Building"?The robin is building a nest in the garden.A nest is a symbol for a safe place where Mary and Colin can grow.The robins are a symbol for new life returning to the garden.Mary and Dickon want Colin to watch the robin building the nest. You estimate that there are 40 marbles in a jar. The actual amount is48 marbles. Find the percent error. Round to the nearest tenth of a percent. help me plz which formula should I use?? What is the pear harbor and what happened 1. When did Texas become a territory of the United States? 5 oranges are bought for $4.00 and later sold at $0.10 each .find the loss percent. What is an advantage to being ectothermic?Question 18 options:Ectothermic animals require much less energy to survive than endothermic animals. Ectothermic animals can sleep longer than endothermic animals. Ectothermic animals always live longer than endothermic animals. Ectothermic animals can live in a greater number of environments than endothermic animals. Why is it important for the brain to be so well protected? Bryson is painting kitchen stools. Each stool requires 1 1/2 liters of paint. Bryson has 20 liters of paint, How many stool will he be able to paint? En France, on sert toujours une salade verte au dbut d'un repas.TrueFalseNEXT QUESTIONASV COR irin How are ionic compounds named? What is the volume of the square pyramid ? Why didnt the Renaissance happen sooner?