Help me please!!!!!!!! :( Past due!!!! No websites/ links/ inappropriate answers or your reported. Worth 20 points please look at all images! Which picture should I use to seem that my hypothesis is inclusive? And please explain why that specific picture

Help Me Please!!!!!!!! :( Past Due!!!! No Websites/ Links/ Inappropriate Answers Or Your Reported. Worth
Help Me Please!!!!!!!! :( Past Due!!!! No Websites/ Links/ Inappropriate Answers Or Your Reported. Worth
Help Me Please!!!!!!!! :( Past Due!!!! No Websites/ Links/ Inappropriate Answers Or Your Reported. Worth

Answers

Answer 1

answer : i suppose the second one is better due to its more in deep explanation hope my opinion helps you


Related Questions


Inherited traits are:
A Dependent on diet
B Acquired during an organism's life
C Free of mutations
D Passed on from parent to offspring

Answers

Answer:

d

Explanation:

The answer is D



Skeiwiw88Sksk’s ...................makes

FREE BRANLIEST IF YOU ANSWER A foul ball can be caught by the defensive team for an out.

Answers

Answer:

TRUE!! IT CAN

Why is it important that the seedling’s true leaves grow quickly?HURRY IM BEING TIMED

to help disperse seeds to areas where they can grow
to shield the seedling from too much water or rain
to protect the seedling from receiving too much sunlight
to make food for the seedling’s continued growth

Answers

Answer:

The correct answer is - to make food for the seedling’s continued growth.

Explanation:

The true leaves that emerge from the seedlings are the leaves that are capable of performing photosynthesis and start generating food and energy. These support the plant for the rest of its life in terms of food and energy.

Seedlings grow from the soil, two leaves in beginning called cotyledons that are not the true leaves and not able to perform photosynthesis and generate their food for the seedling’s continued growth.

Why aren't human hunters a threat to polar bears anymore?

Answers

because the biggest threat to them is climate change!

Its because the Governments of the Arctic States are now regulating such people by  creating laws, restrictions and quotas to polar bear hunting. Some of those are:

-Amount of Polar bears that can be hunted

-Restriction to hunting certain age or gender

-Native people only being allowed to hunt them (excluding Canada) etc

Even capturing has quotas too. Those are:

-Who takes the polar bear

-Amount of Polar bears that can be taken

-The Life they will have while in captivity

I've been looking around for the answer in this interactive website that was included within to answer these questions but, I couldn't find it and I'm wasting time looking for it.

Answers

Answer:

Iron is what mercury is mostly made of

In holly trees, Red fruit (R) are dominant to white fruit (r), and spiny leaves (L) are dominant to smooth leaves (l). Complete the dihybrid Punnett Square to figure out how many of the new holly trees from this cross would be excpected to have white fruit and smooth leaves??


A. 1


B. 2


C. 3


D. 9

Answers

Answer:

All answers are in the image

‼️‼️‼️
PLEASE HELP WILL GIVE BRIANLIEST :))

Answers

Answer:

J SHAPED CURVE GIRL

Explanation:

HOPE THAT HELPS MUAH!

“When graphed, it appears as a J-shaped curve”, and “it occurs under ideal conditions with unlimited resources”

Please help me with this!!

1. Which process plays a part in genetic recombination? A. Asexual reproduction. B. Cytokines. C. Independent assortment. D. Mitotic division.

2. Which correctly lists the following terms in order from smallest to largest? DNA, chromatin, chromosomes, nucleosomes.
A. Chromatin, DNA, Chromatin, nucleosomes
B. Chromosomes,DNA, Chromatin, nucleosomes
C.DNA, nucleosomes, chromatin, chromosomes
D. Nucleosomes, DNA, chromatin, chromosomes

3. In a triploid organism, how many alleles are present for each gene per cell?
A. 1
B. 3
C. 6
D. 9

Answers

I) Independent assortment.

II) Nucleosomes, DNA, chromatin, chromosomes.

III) 3.

EXPLANATION:

Recombination scrambles pieces of maternal and paternal genes, which ensures that genes assort independently from one another.

➻ We know that Chromatin is a complex of DNA and proteins that forms chromosomes. Chromatin looks like beads on a string. The beads are called nucleosomes. Each nucleosome is composed of DNA.

Triploids with three different alleles can easily be detected because they have a unique phenotype.

The process involved in genetic recombination is INDEPENDENT ASSORTMENT. The correct order from smallest to largest is DNA, nucleosomes, chromatin, chromosomes. In a triploid organism, there are 3 ALLELES for each gene.

In independent assortment, different gene variants or 'alleles' are independently and randomly assorted into daughter cells, which allows genetic recombination.

In eukaryotic organisms, DNA is associated with histone proteins in order to form nucleosomes, which arrange in higher organization structures called chromatin fibers.

Subsequently, chromatin fibers condense to form structures called chromosomes.

A triploid organism (3n) contains three sets of homo-logous chromosomes, each one containing one allele for a given locus.

In conclusion, the process involved in genetic recombination is INDEPENDENT ASSORTMENT. The correct order from smallest to largest is DNA, nucleosomes, chromatin, chromosomes. In a triploid organism, there are 3 ALLELES for each gene per cell.

Learn more in:

https://brainly.com/question/10118000

If air pollution causes the rain that falls on this pond to become much more acidic after two years how will this acidity
affect the living things in this pond?
There will be more plants and animals because the acid will kill most of the disease causing microorganisms
There will be more plants and animals because the acid is a source of food,
There will be fewer plants and animals because many of them cannot survive in water with high acidity,
D There will fewer plants and animals because the acid will dissolve many of them,

Answers

Answer:

the guy above me is correct

Explanation:

I know this isn't a explanation so I don't really know why I am putting it under the explanation category but I am really sorry if it is wrong

Consider the satellite images that show topographical maps of Greece before and after fires of 2007. Imagine it is ten years
later.
Which prediction would not be consistent with a third satellite image of the area ten years in the future.
es )

Answers

Answer:

B) Ten years in  the future, that should be little or no change in the satellite  image that we will see

Explanation:

Its on usa test prep and I got it right

The prediction that would not be consistent with a third satellite image of the area ten years in the future is little or no change will occur.

What do you mean by Topographical maps?

Topographical maps may be defined as complicated, accurate graphic representations of features that appear on the Earth's surface.

Every year shows a drastic change in the topographical maps through satellites. It can be said that a period of ten years completely changes the whole sequence and positioning of lives living in a particular area.

Apart from geographical locations, technological advancements, climatic factors, and species may also alter.

Therefore,  the prediction that would not be consistent with a third satellite image of the area ten years in the future is little or no change will occur.

The satellite that detects the views of topographical maps is picturized below:

To learn more about Topographical maps, refer to the link:

https://brainly.com/question/1026002

#SPJ2

PLs, help me with this biology question, please! (I will mark brainliest)

Answers

Answer:

guc is Val = valine

aca is thr =threonine

aug is Met = methionine

uca is Ser = serine

Explanation:

hope this helps

Which of the following is not a concern about nuclear energy?

Answers

Nuclear energy produces less carbon than fossil fuels

what are the 3 ways a species can become isolated and form new species? define what each of them mean.

Answers

Answer:

behavioral isolation, geographic isolation, and temporal isolation

Does light have an effect on carbon dioxide production by plants and animals?

(No Links!! type the answer)

Answers

answer:

Light provides the energy for photosynthetic pig- ments to convert carbon dioxide (CO2) and water into sugars and oxygen. As light intensity increases – until a point – the amount of sugars increases and thus, more energy is available for plant growth and maintenance. hope this helps :D

rashid is conducting a seminar on the importance of coral reefs which point should he include

Answers

Answer:

Protect coastlines from storms, erosion and provide habitat.

Explanation:

Coral reefs protect coastlines from storms and erosion as well as provide a habitat for thousands of aquatic animals. These points rashid must include in his seminar. Coral reefs are very important for the marine ecosystem because it can save the soil from erosion and decreases the intensity of storms by acting just like barrier. It provides food as well as living place for many organisms so these point are very important to be included in the seminar.

Answer:

that corals provide economic assistance to coastal populations through fisheries

Explanation:


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.


Can you please help me with this...

Answers

Answer:

A. Asexual

Explanation:

I majored in Biology

Over time, a series of random occurrences can cause an allele to become more or less common in a population. This is called . When a population is severely reduced by an environmental disaster such as a fire, the result is a due to the reduced genetic diversity of the survivors. 3. The can occur if a small group of organisms migrates to a new location and becomes isolated from the rest of the population.

Answers

Answer:

Over time, a series of random occurrences can cause an allele to become more or less common in a population. This is called Genetic drift.

When a population is severely reduced by an environmental disaster such as a fire, the result is a Bottleneck effect due to the reduced genetic diversity of the survivors.

The Founder effect can occur if a small group of organisms migrates to a new location and becomes isolated from the rest of the population.

Explanation:

Genetic drift is an evolutive force. It is the random change that occurs in the allelic frequency of a population through generations. Its effects are harder in a small-sized population, meaning that the magnitude of this change is inversely related to the size of the original population.  

Genetic drift results in some alleles loss -including the beneficial ones-, while some other alleles get fixated. Low-frequency alleles are the most likely to be lost. The changes produced by genetic drift accumulate in time and results in a loss of genetic variability within a population.  

Genetic drift affects a population and reduces its size dramatically due to a disaster or pressure -bottleneck effect- or because of a population split -founder effect-. The bottleneck effect most likely affects smaller populations.  

The bottleneck effect -a case of genetic drift-, mostly affects smaller populations after the occurrence of a natural disaster or some human action -such as extensive hunting, for instance-. These events might act as a pressure that reduces significantly the number of individuals in a population. In these situations, some alleles are lost, and the survivors have a different genetic charge than the one of the original population. There might be a reduced genetic variability, with a possibility of developing a peculiar allelic component. If the survivors in the population carried or developed a mutation, probably this mutation passed from generation to generation.  

Founder effect refers to the origin of a new population from only a few individuals that are coming from a bigger-sized population. These founder individuals, which are carrying some of the genes of the original population, settle down in a new area and reproduce.  The new and small population might or might not be genetically representative of the original one. Some rare alleles might be exceeded or might be lost by complete. Consequently, when the small population increases in size, it will have a genetically different composition from the original one. In these situations, genetic variability is reduced, and there exists the possibility of developing a peculiar allelic composition. When the number of individuals that originated the new population is low, the founder effect will be very extreme because the genetic drift effects are inversely proportional to the original number of individuals.

Why can't polar bears survive on berries or eggs?

Answers

Answer:

Polar bears that are forced to live on land due to melting ice face lean times in most of the Arctic. Food found on land, such as berries and eggs, lack the high fat content and calories of the bears' preferred prey.

Explanation:

because they aren’t land animals and depend on fish

What are ways that biodiversity loss can be reduced?
Select all that apply.
keeping seeds in seed banks
controlling invasive species
captive breeding
fragmenting habitats

Help FINAL EXAM please

Answers

I think the second one

Como se chama a transferencia de enrgia termica flui de um corpo com maior temperatura quando ao outro de menor temperatura quando ha diferença de temperatura entre ambos

Answers

Answer:

Conduction.

Explanation:

Conduction is the process in which heat energy is transferred from the hotter body towards colder body because of temperature difference between two bodies. Conduction occurs only due to physical contact between two bodies. In the conduction process, the thermal energy flows from a body with a higher temperature to the other body having lower temperature until both bodies having same temperature.

why large spaces present between
spongy mesophyll cells​

Answers

These large spaces allow these layers to help carbon dioxide move around the leaf. The spongy mesophyll also allows the plant to bend and move in the wind, which itself helps move gases around the leaf's cells.

What can be a recessive or dominat??

Answers

alleles, or genes i think

Answer: There are many examples of recessive traits in non-human animals as well. In dogs, traits like yellow fur, white spots, and smooth hair are recessive. In cats, white fur, brown (as opposed to black) fur, and long hair are recessive traits. In sheep, black wool and blue eyes are recessive.

Also Dominant refers to the relationship between two versions of a gene. Individuals receive two versions of each gene, known as alleles, from each parent. If the alleles of a gene are different, one allele will be expressed; it is the dominant gene. The effect of the other allele, called recessive, is masked.

There are many examples of recessive traits in non-human animals as well. In dogs, traits like yellow fur, white spots, and smooth hair are recessive. In cats, white fur, brown (as opposed to black) fur, and long hair are recessive traits. In sheep, black wool and blue eyes are recessive.

Hope this helps

The genetic composition of an organism is called the

Answers

Answer:

The genetic composition of an organism is called the genotype.

100 points (50 each) How do workers decide when to set a controlled burn, and how do they know if they have been successful?

Answers

Answer:

It is very important to have the latest and most updated weather conditions available before starting the burn. Relative humidity is an important factor to consider when planning a controlled burn. If the relative humidity is below 50%, the dryness of the grass is prone to causing very hot fires

What types of change can mutations have?

Answers

Answer:

Explanation:

Base Substitutions. Single base substitutions are called point mutations, recall the point mutation Glu -----> Val which causes sickle-cell disease.

Answer:

Types of Mutations

Missense mutation: This type of mutation is a change in one DNA base pair that results in the substitution of one amino acid for another in the protein made by ...

Nonsense mutation: A nonsense mutation is also a change in one DNA base pair. ...

Insertion or Deletion: An insertion changes the number of DNA bases in a gene by adding a piece of DNA.

Explanation:

Food chains and food webs show how producers, consumers, an decomposers are connected to
one another as chemical energy flows through different
in an ecosystem
a. energy pyramids
b. trophic levels
c.biospheres
d. abiotic components
HELP WILL MARK BRAINLIST

Answers

Answer:

The correct answer is Choice B.

Explanation:

Hope this helps!

Please mark me as Brainlinieast.

Food chains and food webs show how producers, consumers, and decomposers are connected to one another as chemical energy flows through different TROPHIC LEVELS in an ecosystem.

A food web is a complex diagram that exhibits all of the food chains in a given ecosystem.

A food chain is a diagram that represents the transference of matter and energy (as food) from different trophic levels.

A trophic level is defined as a group of organisms in the ecosystem found at the same level in the food chain.

Producer organisms (e.g., plants and algae) are organisms that synthesize their own food.

Consumers (e.g., herbivores and carnivores) are organisms that need to eat organisms from a different population to survive.

Decomposers (eg. bacteria and fungi) are organisms that carry out the process of decomposition by eating dead plants and animals.

In conclusion, food chains and food webs show how producers, consumers, and decomposers are connected to one another as chemical energy flows through different TROPHIC LEVELS in an ecosystem (Option B is correct).

Learn more in:

https://brainly.com/question/13267087?referrer=searchResults

Astronomers have made great strides in sending probes out to other planets and moons in our solar system. If they were to find a living creature some place other than Earth, how could DNA analysis help them better understand the organism? Explain in 1–2 sentences.(2 points)

Answers

Answer:

It could help them understand what ancestors they came from and what species they are most related to.

Explanation:

Prior to the eruption, Mount St. Helens was a recreation destination in southwest Washington with active fishing, hunting, camping, and hiking. Imagine that you were a U.S. Forest Service officer during this time. What restrictions, if any, would you have placed on these activities during the recovery period to protect the ecosystem

Answers

Answer:

No fishing and hunting.

Explanation:

No fishing and hunting is banned in the Mount St. Helens in order to protect the ecosystem. The banning and restriction on these activities will leads to recovery of the ecosystem. Camping and hiking will be allowed because it can't affect fish and other animals in the ecosystem. So I was a U.S. Forest Service officer, I will ban fishing and hunting in the  Mount St. Helens to protect animals in the recovery period.

Hello! Offering 25 points. I need it urgently.

Answers

The somatic nervous system transmits sensory and motor signals to and from the central nervous system. The autonomic nervous system controls the function of our organs and glands, and can be divided into the sympathetic and parasympathetic divisions.

,

Other Questions
david earns an annual salary of $72100 paid biwewkly based on a regular workweek of 36.25 hours. His company generously pays all overtime at twice his regular wage. If david worked 85.5 hours over his course of two weeks, what are his gross earnings. Find the area of thecomposite figure shown below.A.12 cm2B.36 cm2C.24 cm2D.18 cm2 By gaining possessions and influence in Asia and the Amencas during the Spanish-American War, the United States? how do you fix The lag on your zsnes emulator excerpt from Aln't I a Women?by Sojourner Truth (from the Anti-Slavery Bugle)Sojourner Truth was born into slavery in the United States and gained her freedom as an adult. She gave this speech in 1851 at a women's right'sconventionI want to say a few words about this matter of women's rights). I am a woman's rights [reformer). I have as much muscle as any man, and can do asmuch work as any man. I have as much muscle as any man, and can do as much work as any man. I have plowed and reaped and husked andchopped and mowed, and can any man do more than that? I have heard much about the sexes being equal; I can carry as much as any man, and caneat as much too, if I can get it. I am strong as any man that is now.As for intellect, all I can say is, if woman have a pint and man a quart-why can't she have her little pint full? You need not be afraid to give us ourrights for fear we will take too much--for we won't take more than our pint'll hold.The poor men seem to be all in confusion and don't know what to do. Why children, if you have woman's rights give it to her and you will feel better.You will have your own rights, and they won't be so much trouble.I can't read, but I can hear. I have heard the Bible and have learned that Eve caused man to sin. Well if woman upset the world, do give her a chancetn cat it right side in again The lady has croken ahnut locus how he never enurned woman from him and she was right When I azarus dior Marv7Select the correct answer.What type of claim is Truth making in her speech?OA.a. Truth is making a fact claim by challenging the meaning of freedom.b. Truth is making a cause claim by suggesting that Eve's sin caused men to treat women unfairlyc. Truth is making a policy claim by challenging the problematic policy of not providing women the same rights as men.d. Truth is making a value claim by suggesting that women deserve more rights than men. Which is a reasonable conclusion from the information presented in the bar graph? A. Illinois had more electoral votes in 2000 than in 1980. B. Most of the states had more electoral votes in 1980. C. Most of the states had more electoral votes in 2000. D. Arizona had the largest increase in electoral votes. why was the conflict between the us and soviet union following ww2 described as the cold war? A beach volleyball court is 9 meters wide and 17 meters long. The rope used for the boundary line costs $4.00 per meter. How much would it cost to buy a new boundary line for the court? If a farmer fertilizes her fields and then a huge rainstorm takes place,what might happen to the fish in a nearby lake? Explain thoroughly andinclude vocabulary from each of the cycles. Does anyone mind helping? hello please help ill give brainliest simplify 3+4(y-7)+5y Tomorrow the last day of school how ya feel?-franz:) (hurry pls)Carl plugs in a lamp that has 0.67 of resistance and 8.1 volts running through it. What is the amount of current running through the lamp? C 543 A C 0.08 A C 12.09 A C743 A Write the opposite of each integer.-(-8)-(-65)PLS HELP ME TYSM Draw and use algebra tiles to solve the equation. 2x + 3 = 5 x = People in the Warehousing and Distribution center pathway create safety procedures that employees follow.TrueFalse HELPP ITS ALMOST DUE PLEASE What is the total amount of force needed to keep a 6.0 kg object moving at speedof 5.0 m/s? (F=ma)A. 30 NB. 60 NC.OND. 10 N HELP ASAP PLS NO LINKS!What caused conflict between the North and the South when Kansas andNebraska prepared to become states?A. Many Northerners believed that no new states should be added.O B. Many Southerners argued that the new states should allowslavery.C. Many Northerners hoped to limit the new states' political power.D. Many Southerners worried that the new states would vote forDemocrats.SUBMIT