HELP ME, I need to get the value of the numbers

HELP ME, I Need To Get The Value Of The Numbers

Answers

Answer 1

Step-by-step explanation:

Every line = 180 degrees

First subrtact 75 from 180

After that, you have p1, p5, n7, and m3 = 108

Then that gives you the answer to the rest of them

p4 p8 and n6 = 75

Side note: If I were you I would study so that I could actually answer the questions when I'm being called on, but I get it.

Answer 2
the answer is 75!!!!!!

Related Questions

PLZ HELP NEED NOW! I WILL GIVE BRAINLIEST TO FASTEST PERSON WITH WORK!
how do you change y – 5 = - (x – 1) into slope intercept form?

Answers

Answer:

y = -x + 6

Step-by-step explanation:

Slope intercept form is y = mx + b.

So distribute the negative sign on the right side to get:

y - 5 = -x +1

Then  add the 5 on the left side to both of the sides to get y alone, then you will get:

y = -x +6

That is in slope intercept form.

Y=-x+6 plz give me brainlist :(

Solve the equations in Parts A and B using inverse operations. Check your solutions. In your final answer, include all of
your work
Part A: 5 + 2 = 232 + 13
Part B:5 + 1 = 23% + 13

Answers

Answer:

Part A: 7 = 245

Part B: 6 = 1323/100

Step-by-step explanation:

Part A: Add the numbers 5 and 2 which you get 7 and then you add 232 and 13 which gives you 245

equation version: 5 + 2 = 7

232 + 13 = 245

7 = 245

Part B: In order to convert a precent to a ratio, divide it by 100

23/100

5 + 1 = 23/100 + 13

5 + 1 = 6

23/100 + 13 = 1323/100

6 = 1323/100

Hope this helps :)

Answer: B

Lamar puts 3 cantaloupes that each weigh 2 pounds onto a scale. He adds 3 bunches of bananas that each have the same weight to the scale. If the total weight of the fruit is 18 pounds, what is the weight of one bunch of bananas? Write the equation and solve for the unknown.

Answers

4 is the weight of one bunch 6X4=18.

The answer iss 4 => so yes

Write an expression for the sequence of operations described below. u minus the sum of v and t Do not simplify any part of the expression.

Answers

Answer:U-v+t

Step-by-step explanation:Hope this helps. U minus the sum of v is u-v. This means that v is positive and is being subtracted by u. The sum of v and t. Would be addition so v+t. The equation is u-v+t.

Trick question what is 1+(6+8)×3? Did you get it correct?
(A) 25
(B) 24
(C) 23
(D) 10




























The answer is...




















Guess! lol

Answers

6+8= 14+1=15 times 3 shouldnt it be45?

A community group is picking up trash along a portion of the highway that is 1.48 miles long. In one hour they can clean a section about 1/8 mile long. Approximately how many hours will it take the group to clean the stretch of highway?
Please help ASAP
The answers are
3/16
16/3
2
12

Answers

Answer:

12 if im correct

Step-by-step explanation:

first we have to see that they are doing 1/8 of a mile per hour so if we divide 1.48 by 1/8 it should give us the time

first we convert 1/8 to a decimal which is .125 and we divide 1.48 by .125

giving us 11.84

since it is time, 11 hrs would be too little of a time so we need to round up to 12

Hope thats right

The number of hours for the group to clean the stretch of highway is A = 12 hours

What is an Equation?

Equations are mathematical statements with two algebraic expressions flanking the equals (=) sign on either side.

In an equation, the expressions on either side of the equals sign are called the left-hand side (LHS) and the right-hand side (RHS), respectively. The equals sign (=) indicates that the two expressions have the same value, and that the equation is true for certain values of the variables involved.

Coefficients, variables, operators, constants, terms, expressions, and the equal to sign are some of the components of an equation. It typically consists  mathematical operations, such as addition, subtraction, multiplication, division, and exponentiation.

Given data ,

Let the number of hours be represented as A

Now , the value of A is

If the group can clean 1/8 mile of the highway in one hour, we can calculate how many sections of 1/8 mile are in 1.48 miles:

1.48 miles / (1/8 mile per section) = 11.84 sections

On simplifying the equation , we get

This means that the group will need to clean 11.84 sections of 1/8 mile each to clean the entire stretch of highway.

Since they can clean 1 section in 1 hour, it will take them 11.84 hours to clean the entire stretch of highway ≈ 12 hours

Hence , the number of hours to clean the highway is 12 hours

To learn more about equations click :

https://brainly.com/question/19297665

#SPJ2

Liam is setting up folding chairs for a meeting. If he arranges the chairs in 6 rows of the same length, he has 9 chairs left over. If he arranges the chairs in 4 rows of that same length, he has 21 left over. How many chairs does Liam have?
pls help

Answers

Answer:

45

cause the answer is :)

The answer to the problem is 45because 6x6 equals 36 and if 9 chairs are left over add that and you will have 45

Can you please help?

Answers

Answer:

I THINK THIS IS RIGHT BUT I'M NOT SURE

3= x divided by 4

5= 3+x

7= x divided by 3

9= 9 times x

11= 4 plus 1/2

13= I DONT KNOW

15= (x times 5)+3

17=(4 times x)+4

19=(x+2)8

Step-by-step explanation:

1) x+5
3) n/4 (n divide by 4)
5) 3+n
7) n/3 (n divided by 3)
9) 9n
11) 4+1/2n
13) 1/2n-10
15) 3+5n
17) 4+3n
19) 8(n+2)

Hope this helps!

The Dockland Building in Hamburg, Germany is shaped like a parallelogram.


If the length of the building is 86 meters and its height is 55 meters, what is the area of the face of the building?

Group of answer choices

4,730 meters

4,730 square meters

Answers

Answer:

4,730

Step-by-step explanation:

Multiply 86 by 55 to get 4730

The area of the face of the  building is 4,730 square meters

Using this formula

Area=Length×Height

Where:

Length of the building=86 meters

Height of the building =55 meters

Let plug in the formula

Area=86 meters×55 meters

Area=4,730 square meters

Inconclusion The area of the face of the  building is 4,730 square meters

Learn more here:

https://brainly.com/question/22740526

Round 9.17302 to the nearest thousandths, tenths, and nearest unit.

Answers

Answer:

i think its 17000 and 170000

Step-by-step explanation:

Answer:

Thousandths: 9.173

Tenths: 9.2

Nearest Unit:  9

Hope this helps :D

Based on the figure, what should be concluded about the density of the iceberg compared to to the density of seawater? Explain.

-Based on the figure, what should be concluded about the density of the iceberg compared to the density of the treasure chest? Explain.

Answers

not so sure , but you’ll get it z

Find the difference between and 8/15 - -(2/3). Show all calculations in your final answer please!! :)

Answers

6/5 is the answer and btw i am learning that it is so easy and you got it girl

Answer:

[tex]\boxed{\dfrac{34}{15}}[/tex]

Step-by-step explanation:

[tex]\text{Use }\LaTeX[/tex] (ノ◕ヮ◕)ノ*:・゚✧

[tex]\dfrac{8}{5} - - \left(\dfrac{2}{3}\right)[/tex]

[tex]\dfrac{8}{5} - \left[-\dfrac{2}{3}\right][/tex]

[tex]\dfrac{8}{5} +\dfrac{2}{3}[/tex]

[tex]\dfrac{8(3)}{5(3)} +\dfrac{2(5)}{3(5)}[/tex]

[tex]\dfrac{24}{15} +\dfrac{10}{15}[/tex]

[tex]\boxed{\dfrac{34}{15}}[/tex]

One month, an animal shelter places 2/5 of its animals into foster care. If there were 45 animals at the shelter that month, how many were placed in foster care?

Please help because this is timed!

Answers

Answer:

18

Step-by-step explanation:

16

Step-by-step explanation:

omg, I'm so sorry people but it's a lot... -_-

Answers

Answer: pretty sure it’s proportional

Step-by-step explanation:

Evaluste 48/6 - 10/3
(A) 12 2/3
(B) 4 2/3
(C) 4 1/3
(D) 9 1/3

ANSWER ASAP

Answers

An:
48/6- 10/3 =
(B) 4 2/3

Hi it will be so nice if u could help me thx!

Answers

Answer:

11. Domain: (-infinity, +infinity)  Range: (-infinity, +infinity)

12. Domain: (-infinity, +infinity)  Range: f(x) = 25

13. Domain: (-infinity, +infinity)  Range: (-infinity, +infinity)

Step-by-step explanation:

Thanks for the free points btw, and sorry.

Javier walks from his house to the zoo at a constant rate. After walking 0.75 mile, he meets his brother, Raul, and they continue walking at the same constant rate. When they arrive at the zoo, Javier has walked for 0.5 hour and Raul has walked for 0.2 hour. Which equation can be used to find r, the rate in miles per hour at which the brothers walked to the zoo?

A 0.2r = 0.5r

B 0.2r + 0.75 = 0.5r

C 0.5r + 0.75 = 0.2r

D 0.75r = 0.5r + 0.2r

Answers

Answer:

B

Step-by-step explanation:

Ruby weighs 88 lbs. Her weight is 12 lbs. less than half her mother's weight. How much does her mother weigh?

Answers

88 = m - 12

+ 12       + 12

100 = m

Answer:

Ruby's mother weighs 200 lbs.

Step-by-step explanation:

88 + 12 = 100

100 x 2 = 200

Can somebody please help me with these two problems ASAP I’d highly appreciate it.

Answers

Answer: 7

Step-by-step explanation:

See attached picture

What is the answer of this

Answers

-48 would be the answer

please help, this is 7th grade math

Answers

Answer:

its -1 and 3/4

Step-by-step explanation:

because u have to find a common denominator first and then a negative plus a positive is a negative so i hope this helps i just learned this like two weeks ago

-3/4.

When there is a plus and a minus sign, it means add a negative, so take out the plus sign.

1/2-5/4

Find like terms

2/4-5/4

2-5 =-3

4. =4

Therefore the answer is -3/4

Why is it useful to write 6.51 as 6.510?

Answers

I mean it saves abit of time I guess. 6.51 and 6.510 are equivalent. That zero doesn’t add anything.
It’s the same thing.

Explain your answer, please
。 • ゚ 。 . . . 。 。 . . 。 ඞ 。 . • • ゚
round your answer to the nearest armadillo

Scale Factor of Triangle STU to Triangle PQR
Scale Factor of Triangle PQR to Triangle STU

Scale Factor of Trapezoid EFGH to Trapezoid JKLM =
Scale Factor of Trapezoid JKLM to Trapezoid EFGH

Answers

.1.Scale Factor of Triangle STU to Triangle PQR= 1.5

2.Scale Factor of Trapezoid EFGH to Trapezoid JKLM =2

3. about 90 armadillo

1.Side ST: 15 ÷ Side PQ: 10 = 1.5

2.Side JM: 14 ÷Side EH: 7 = 2

3.843/7=120.428571429

843/4=210.75

210.75-120.428571429=90.321428571

This rounds to 90 armadillo

Hope this helps :3 ❤

Look at triangle ABC.

Coordinate grid shows negative 5 to positive 5 on the x axis and y axis at intervals of 1. A triangle ABC is shown with A at ordered pair 4, 5, B at ordered pair 2, 2, and C at ordered pair 4, 2.
What is the length of side AB of the triangle? (1 point)


3

5

Square root of 6

Square root of 13

Answers

Answer:

5 oooor square root of 6

Step-by-step explanation:

i drew a coordinate plane (grid) and

i put them all down but i couldnt make out wether it was 5 or if it would be

the square root of 6 really sorry

hope this helped

Answer:

square root of 13!

Step-by-step explanation:

Kim says the answer to 10 times 3 and StartFraction 8 Over 9 EndFraction is 13 and StartFraction 8 Over 9 EndFraction. Is her answer reasonable? No, because 3 and StartFraction 8 Over 9 EndFraction is about 4, and 10 × 4 is 40. Yes, because 3 and StartFraction 8 Over 9 EndFraction is about 4, and 10 × 4 is 14. Yes, because 3 and StartFraction 8 Over 9 EndFraction is about 3, and 10 × 3 is 30. Yes, because 3 and StartFraction 8 Over 9 EndFraction is about 3, and 10 × 3 is 13.

Answers

Answer:

alright the density of air affects mass of a object since this formula affect newtons law 14*/45 */ 149851*412

Step-by-step explanation:

Answer:

its A brainly plz

Step-by-step explanation:

The original quantity is 20 and the new quantity is 15. Adam incorrectly says the percent decrease is about ​14.29%. What is the correct percent​ decrease? What error did Adam likely make when finding the percent​ decrease?

What error did Adam likely​ make? A. divided the difference of the two quantities by the sum of the two quantities. B. divided the difference of the two quantities by the product of the two quantities. C. divided the difference of the two quantities by the new quantity. D. divided the new quantity by the original quantity.

Answers

A is your answer :))

Answer:

A

Step-by-step explanation:

If the relationship is proportional, what is the missing value from the table?

Answers

Answer:

The answer is 15. I know this because they are all multiplied by 3.

Step-by-step explanation:

I go to that school as well

answer is 15 i think sorry if I’m wrong doe

Can someone Please help me and quick An d show the work all of it

Answers

Answer:

A

Step-by-step explanation:

Like terms must have the same exponents and variables, but can have different coefficients

a is the answer if u get it wrong im soooo sryy

-6x - 16 < 2x

help plz

Answers

Answer:

-2 < x

Step-by-step explanation:

-6x - 16 < 2x

Add 6x to each side

-6x+6x - 16 < 2x+6x

-16 <8x

Divide by 8

-16/8 < 8x/8

-2 < x

Answer:

so the way this problem looks i have to solve for -16-16 so

the simple answer is -32x<2x  

Step-by-step explanation:

all i did was subtract 16 from -16 which vise versa would be 32 butwith the negative 16 and minus 16 its just -32

WILL MARK BRAINLIEST, HELPPPP





go listen to some music and relax, you deserve it :)

Answers

Answer:

Yes I will thank you!

Step-by-step explanation:

Okay I will thank you :)
Other Questions
if you ride your bike around the block, returning to the exact point where you started, your displacement is _____m?help please In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop ) essay on my future ambition as a teacher After conquering China, the Mongols created theHan Dynasty.Ming Dynasty.Song Dynasty.Yuan Dynasty. P5.30 Having a secure password is a very important practice, when much of our information is stored online. Write a program that validates a new password, following these rules: The password must be at least 8 characters long. The password must have at least one uppercase and one lowercase letter. The password must have at least one digit. Write a program that asks for a password, then asks again to confirm it. If the passwords dont match or the rules are not fulfilled, prompt again. Your program should include a function that checks whether a password is valid. The concentration of the solute in the solution is the same as in the cell the rational number 9.8 is the best approximation to the tenth of which irrational number?89 squared92 squared96 squared98 squared Which of the following reasons led the Texans to revolt against the Mexican government? A. A tax on cotton? B. Outlawing Slavery? C. Annexation of California? or D. Forcing Texans off their land? Why did slavery come to a halt in the 1750s? i need help with this too please A random telephone survey of 1021 adults (aged 18 and older) was conducted by Opinion Research Corporation on behalf of CompleteTax, an online tax preparation and e-filing service. The survey results showed that 684 of those surveyed planned to file their taxes electronically.a. Develop a descriptive statistic that can be used to estimate the percentage of all taxpayers who file electronically.b. The survey reported that the most frequently used method for preparing the tax return was to hire an accountant or professional tax preparer. If 60% of the people surveyed had their tax return prepared this way, how many people used an accountant or profes-sional tax preparer what did the two world wars change? can you plzzzzzzzzzzzz help me What is 6/20 of a dollar BRAINLIEST IS RIGHT WILL BE MARKED BRAINLIEST AND PLUS 12 POINTS Which detail from the passage best explain why plants photosynthesize? Let S = {1, 2, 3, 4, 5, 6, 7, 8, 9), A = { 1, 2, 3, 4, B= {2, 4, 6, 8} andC= {3, 4, 5, 6). Find (i) A (ii) An C (iii) (An CY (iv) A UB (V) BIC What is the slope of the line that passes through the points (3,5) and ( 1, 5)? Write your answer in simplest form. Which choice shows the correct sequence or order of events for a scientific experiment?A) Perform experiment -> Form hypothesis -> Analyze data -> Draw conclusions B) Analyze data -> Form hypothesis -> Perform experiment -> Draw conclusions C) Perform experiment -> Analyze data -> Draw conclusions -> Form hypothesis D) Form hypothesis -> Perform experiment -> Analyze data -> Draw conclusions What is the value of the expression below when x=8? 10x+5