Hello! Please ignore the stuff I already wrote, can someone help me find x and y?

Hello! Please Ignore The Stuff I Already Wrote, Can Someone Help Me Find X And Y?

Answers

Answer 1

Answer:

x=12

y=[tex]12\sqrt{3}[/tex]

Step-by-step explanation:

Hey There!

to solve this problem we need to use the 30 - 60 - 90 triangle rule

So you are correct on x because the hypotenuse is 2x

24/2=12

y would equal [tex]12\sqrt{3}[/tex]

as you could see in the image down below

Hello! Please Ignore The Stuff I Already Wrote, Can Someone Help Me Find X And Y?

Related Questions

Simplify. Write the answer as a decimal.

Answers

Answer:

what are we simplifying

If a=-3, then - (a4) =
A -12
B 81
C-81
D 12

Answers

Answer is D. 12 the negative makes the -3 a positive 3 and then you just multiply 3 and 4 which is 12

plz help me with this

Answers

Answer:

11 shots

Step-by-step explanation:

60% of 18 = 10.8

10.8 rounded = 11

Why we did this:

Owen made 60% of the shots he made, and he made 18 shots in total. Therefore, we would take 60% of 18.

The answer we get is 10.8, but we can't have a part of a shot. That wouldn't make sense. Therefore, we have to round up to 11 shots.

please help me with this :)

Answers

Answer:

A

Step-by-step explanation:

Answer:

just use photo math on your phone or tablet bro

Step-by-step explanation:

download it on the app store

a. How much warmer is 82 than 40?
b. How much warmer is 82 than -40?
a. What is the difference in height between 30 m up a cliff and 87 m up a cliff? What is the distance between these positions?
b. What is the difference in height between an albatross flying at 100 m above the surface of the ocean and a shark swimming 30 m below the surface? What is the distance between them if the shark is right below the albatross?

Answers

Answer:

a. 42

b. 122

a. 57

b. 130

Step-by-step explanation:

For problem A:

because both of these values have positive numbers, just use normal subtraction

82 - 40 = 42 degrees warmer

For problem B:

because we are subtracting a negative number from a positive number, we add both of these numbers because 82 - -40 can also be equal to 82 + 40

82 - -40 = 122

For problem A:

the sentences 30m up a cliff and 87m up a cliff are describing positive values.

87 - 30 = 57

For problem B:

Now in this problem, the sentence 100m above the surface is describing a positive value, but the sentence 30m below the surface describes a negative value

how do I know this?

if the sentences above the surface and below the surface are describing positive and negative values, then there has to be a neutral value ( which is 0)

0 meters = the surface, because they are using both positive and negative values, meaning that the surface is the neutral value

by using a number line, you can draw it out like this

below the surface-------------------------the surface----------------------------above the surface

-30--------------------------------------------0--------------------------------------------100

therefore, 100 - - 30 = 100 + 30 = 130

A thief steals an ATM card and must randomly guess the correct six digit passcode from a five key keypad repetition of digits is allowed what is the probability of a correct guess on the first try

Answers

Answer: 1%

Explanation: sorry if I’m wrong.

A theory predicts that the mean age of stars within a particular type of star cluster is 3.3 billion years, with a standard deviation of .4 billion years. (Their ages are approximately normally distributed.) You think the mean age is actually greater, and that this would lend support to an alternative theory about how the clusters were formed. You use a computer to randomly select the coordinates of 50 stars from the catalog of known stars of the type you're studying and you estimate their ages. You find that the mean age of stars in your sample is 3.4 billion years.

Answers

Answer:

The answer to this question can be defined as follows:

Step-by-step explanation:

Please find the complete question in the attached file.

Lets [tex]\mu[/tex] in trillions of years be the maximum likelihood age of galaxies in a certain type of star cluster.

Calculating the Hypotheses:

Null hypothesis value:[tex]H_o : \mu = 3.3[/tex]

Alternative hypothesis value: [tex]H_A : \mu > 3.3[/tex]

If you jog 8 times around a track that is 600 meters long, how many kilometers have you covered?

Answers

Answer:

0.6 km

Step-by-step explanation:

If If you jog 8 times around a track that is 600 meters long, then 4.8  kilometers you  have covered

What is Unit of Measurement?

A Unit of measure is the actual unit in which the associated values are measured.

Given,

If you jog 8 times around a track that is 600 meters long,

We need to find how many kilometers you have covered.

8 times around a track that is 600

It means we have to multiply eight with six hundred.

8×600

=4800

We know that 1 km is 1000 m

So divide 4800 by 1000 to find in kilometers

4800/1000=4.8km

Hence If you jog 8 times around a track that is 600 meters long, Then 4.8  Kilometers you have covered.

To learn more on Units of measurement click:

https://brainly.com/question/15402847

#SPJ2

A piano turner charges $63 for 1.5 hours of work. Which proportion can be used to find x, the number of dollars the piano turner charges for 4 hours of work?

Answers

$63. 1.5 hrs
$x. 4 hrs

63/x=1.5/4

x=63•4/1.5
x=252/1.5
x=168$

1. Andre earns $4000 a month at his new job. In order to track his spending and saving, he created a monthly
budget. Andre divided his income into five categories and created the following circle graph to represent the
budget he created for himself. Use this circle graph to answer the following questions.
Monthly Budget
Other, 22%
Rent
33%
Savings
25%
Groceries,
12%
Utilitites
8%
(a) Andre is planning on renting a new apartment, but he wants to stay within his budget on and
utilities. Andre is looking at two apartments: Apartment 1 and Apartment 2. Apartment 1 costs $1100
per month, plus $250 for utilities. Apartment 2 costs $1350 per month, plus $100 for utilities. Which
apartment should Andre choose?
(b) Explain your reasoning in a minimum of 3 sentences or more.
Answer:

Answers

Answer:

If Andre plans on staying within his budget, he should choose Apartment 1.

Step-by-step explanation:

Apartment 1: $1100 rent + $250 utilities = $1350 Total Monthly

Apartment 2: $1350 rent + $100 utilities = $1450 Total Monthly

Andre can spend up to $1320 on rent & $320 on utilities, totaling at $1640. In this situation, Andre needs to save as much money as possible. Either on one of these apartments stay below the budget for monthly cost, but Apartment 2's rent goes $30 higher than his budget allows. In the end, this makes apartment 1 the best option for rent, utilities, and ultimate cost.

If Andre plans on staying within his budget, he should choose Apartment 1.

Andre would choose apartment 1 because its cost of rent and utilities is less than the budgeted costs of rent and utilities

A pie chart is shows information in a circle. The sum of angles in a pie chart is 360 degrees and the sum of percentages is 100.  

The first step is to determine the total amount Andre can spend on rent according to the budget.

Total amount of budget = percentage of budget to be spent on rent x total income

33% x $4000

= 0.33 x $4000 = $1320

The second step is to determine the total amount of the budget that would be spent on utilities

Total amount to be spent on utilities = percentage of utilities  x total income

8% x $4000

0.08 x $4000 = $320

The cost of rent and utilities of apartment 1 is less than the cost of the budgeted cost. While the cost of rent of apartment 2 is greater than the budgeted rent and its utilities is less than the  and the budget for utilities. This makes Apartment 1 more appropriate.

To learn more about pie charts, please check: https://brainly.com/question/5870339?referrer=searchResults

Can someone help please!! Thank you

Answers

2nd answer (not similar, sides are not proportional)

find the missing height.

Answers

Answer:

h = 12 units

Step-by-step explanation:

Area of parallelogram  = 84 square units

Height = area ÷ base

  h   = 84 ÷ 6

h = 12 units

What are the x-intercepts of the function f(x) = -2x2 – 3x + 20?
OAC) and (4,0)
O B.(-2, 0) and (5,0)
O C.(-4,
* (-4, 0) and (0)
O D.(-5,0) and (2.0)

Answers

Answer:

the interception of the function will be equals -2x+5 And x-4

I guess

2. Ava bought a new computer and is now
$249 in debt. How much money does Ava have? (-$249)
What does $0 represent in this problem?

Answers

Answer:

Ava has 0 dollars and zero represents the money she has.

Step-by-step explanation:

1. Find the measure of the given angle.
156°
L
N
?
M
124

Answers

Answer:

40°

Step-by-step explanation:

360-156-124=80

80/2=40

Solve for x
x^2+ 6x + 9 = 12

Answers

Answer:

x=−3+2√3 or x=−3−2√3

Step-by-step explanation:

the sum of three consecutive integers is -51 what is the value of the smallest number

Answers

Answer: Let's say the first number is x, the next one is x+1, and so on

Step-by-step explanation:

x + (x + 1) + (x + 2) = -51

x + x + 1 + x + 2 = -51

3x + 3 = -51

3x = -54

x = -18

A researcher wants to see if a kelp extract helps prevent frost damage on tomato plants. One hundred tomato plants in individual containers are randomly assigned to two different groups. Plants in both groups are treated identically, except that the plants in group 1 are sprayed weekly with a kelp extract, while the plants in group 2 are not. After the first frost, 12 of the 50 plants in group 1 exhibited damage and 18 of the 50 plants in group 2 showed damage. Let p1 be the actual proportion of all tomato plants of this variety that would experience damage under the kelp treatment, and let p2 be the actual proportion of all tomato plants of this variety that would experience damage under the no-kelp treatment.

Required:
Construct and interpret a 95% confidence interval for the true difference in the proportion of tomato plants like these that would experience damage after receiving the kelp treatment and no-kelp treatment.

Answers

Answer:

The 95% confidence interval for the true difference in the proportion of tomato plants like these that would experience damage after receiving the kelp treatment and no kelp treatment is -0.2690 < [tex]\hat{p}_1-\hat{p}_2[/tex] < 0.02901

Step-by-step explanation:

The given data are;

The number of the group 1 plants that exhibited damage = 12

The number of plants in group 1, n₁ = 50

The number of the group 2 plants that exhibited damage = 18

The number of plants in group 2, n₂ = 50

The proportion of group 1 plants that exhibited damage, [tex]\hat p_1[/tex] = 12/50 = 0.24

The proportion of group 2 plants that exhibited damage, [tex]\hat p_2[/tex] = 18/50 = 0.36

The z-value at 95% = 1.64

The confidence interval is given by the following formula;

[tex]C.I. = \hat{p}_1-\hat{p}_2\pm z^{*}\sqrt{\dfrac{\hat{p}_1\left (1-\hat{p}_1 \right )}{n_{1}}+\dfrac{\hat{p}_2\left (1-\hat{p}_2 \right )}{n_{2}}}[/tex]

Plugging in the values, we get;

[tex]C.I. = 0.24-0.36\pm 1.64 \times \sqrt{\dfrac{0.24\left (1-0.24 \right )}{50}+\dfrac{0.36\left (1-0.36 \right )}{50}}[/tex]

Therefore, C.I. = -0.2690 < [tex]\hat{p}_1-\hat{p}_2[/tex] < 0.02901

Someone pleaseee help it should be easy!!!!

Answers

Answer:

5

Step-by-step explanation:

First,let find the area of AMY. It is given that

Am=5

MY=7

AY=3

We can add up those numbers to find the perimeter.

5+7+3=15.

2. Since AMY and MEG are similar shapes, there side lengths are proportional, and their perimeter is also proportional.

The only transformation that can accomplish that is a dilation.

MEG is a dilation of AMY by 1/3. so that means MEG is 3 times smaller than AMY.

We would just divide 3 by the perimeter of AMY to find MEG.

[tex] \frac{15}{3} = 5[/tex]

factor (5a–3b)^2–25a^2 PLS HELP 50 POINTS

Answers

Answer:

(-3b) (10a -3b)

Step-by-step explanation:

(5a–3b)^2–25a^2

Replace (5a–3b) with x

x^2 - (5a) ^2

We have the difference of squares

( x-5a) (x+5a)

Now replace x with (5a -3b)

(5a -3b -5a) ( 5a -3b +5a)

Combine like terms

(-3b) (10a -3b)

Answer:

(5a-3b)²-25a²

= 25a²+9b²-2×5a×3b-25a { (a-b)²= a²+b²-2ab}

=9b²-30ab

=3b(3b-10a)

= -3b(10a-3b)

Ans

Hope, it helped!

How many miles are in 3227 feet? (1 foot=5280 miles) Round to the nearest tenth.

Answers

0.6111742 Miles

Please Mark Brainliest!

Answer:

.6

Step-by-step explanation:

will technically there is 0.6111742 in a 3227 because you divide 3227 by 5280


Miguel is making trail mix. He uses 5 1/3 ounces of nuts and 2 3/4 ounces of raisins. Which
of these is a reasonable estimate for how much more nuts Miguel uses than raisins?



HELP FAST

Answers

It doesn’t show which options?
But the difference would be 2 7/12 or 2.58

3y + 2 + 2y + 5 =x + y + 2y – 4 =

Answers

Answer:

This is your answer ☺️. If I'm right so,

Please mark me as brainliest. thanks!!!

After completing this activity, what is your initial explanation of how the populations of predators and prey are related?

Answers

Step-by-step explanation:

prey and predators depends in each other .in the absence of one another is useless or meaning less. predators is responsible for population of prey.if less predators more prey and more predators means less prey.

Answer:

they both eat food

Step-by-step explanation:

Fred is a new student who just joined our class. Fred needs help. Please explain to Fred how he can determine which numbers are rational and which numbers are irrational.

Answers

Answer:

tell fred to go to another school

Step-by-step explanation:

Calculate cose to two decimal places.

Answers

Answer: its b

Step-by-step explanation:

Your answer would be B

A box of corn flakes has a square base with sides that measure 7 centimeters in length and the height of the box is 20 centimeters. If V represents the volume of the box, what is the maximum volume of corn flakes this box can hold?
A. 900
B. 925
C. 950
D. 980

Answers

Answer:B

Step-by-step explanation:

Answer:

its B

Step-by-step explanation:

Trevor was paid $960 last week for working 40hours. What is Trevor's hourly pay rate before taxes?

Answers

He gets paid 24 dollars an hour 960/40=24

Answer:

He gets paid 24 dollars an hour 960/40=24

What is the area of 54 ft

Answers

Answer:Surface Area = 6×542 = 17496 feet2

Step-by-step explanation:

Courtney is ordering nachos at a restaurant, and the server tells her that she can have up to three toppings: pico de gallo, onions, and steak. Since she cannot decide how many of the toppings she wants, she tells the server to surprise her. If the server randomly chooses which toppings to add, what is the probability that Courtney gets just onions and steak

Answers

Answer:

[tex]Probability = \frac{1}{9}[/tex]

Step-by-step explanation:

Given

Toppings: Pico de gallo, Onions and Steak

Required

The probability of getting Onions and Steak

The probability is calculated using:

[tex]Probability = P(Onion)\ and\ P(Steak)[/tex] --- because the events are independent

[tex]P(Onion) = \frac{n(Onion)}{Total}[/tex]

[tex]P(Onion) = \frac{1}{3}[/tex]

[tex]P(Steak) = \frac{n(Steak)}{Total}[/tex]

[tex]P(Steak) = \frac{1}{3}[/tex]

So, we have:

[tex]Probability = P(Onion)\ and\ P(Steak)[/tex]

[tex]Probability = P(Onion)\ *\ P(Steak)[/tex]

[tex]Probability = \frac{1}{3} * \frac{1}{3}[/tex]

[tex]Probability = \frac{1}{9}[/tex]

Other Questions
What role does Janes ambiguous social position play in determining the conflict of her story? (its based on the book Jane eyre)I need this ASAP! DQuestion 2If a right triangle has side lengths 6, 6.7 and 3, which side is the hypotenuse?O 3O 6.7O 15.706 What characteristics do Percy and his mother have in common? How do they differ? Plz help me!Plz well mark brainliest if correct! distace x time graph will be ................ if the body is in ununiform motion Was there a contradiction between Balfours proposal to establish a national home for the Jewish people and the promise that nothing shall be done which may prejudice the civil and religious rights of existing non-Jewish communities in Palestine? If so, why did he make two contradictory promises? argumentative essay on genetically modified foodsCAN SOMEBODY HELP ME WITH DIS PLZZ DONT PUT ANYTHANG SLOW PLZZ help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks.