For most Latin American countries, the 1800s were the Era of __________. A. Independence B. Colonization C. Columbian Exchange D. Exploration Please select the best answer from the choices provided. A B C D

Answers

Answer 1

Answer:

Independence

Explanation:

Columbian Exchange was 15th and 16th century, colonization and exploration was the pre-Columbian exchange I'm pretty sure.

Answer 2

Answer:

independece

Explanation:

took the quiz


Related Questions

what do you mean by monopoly market​

Answers

Answer:

the market is run by companies who have bought out most of the competition

Answer:

A market structure characterized by a single seller, selling a unique product in the market. In a monopoly market, the seller faces no competition, as he is the sole seller of goods with no close substitute.

state 2 ways in which stress could impact negativly on students performance at university​

Answers

The student can lack on doing their work and not give their best effort in class or will not participate


Which of the following describes a protected turn?

A. A barrier separates turning traffic from oncoming traffic.
B. A police officer is on duty to prevent crashes.
C. Cross traffic is stopped with a red light.
D. Cross traffic and oncoming traffic are stopped with a red light.
Type here to search

Answers

Answer:

The option which describes a protected turn is:

D. Cross traffic and oncoming traffic are stopped with a red light.

Explanation:

A protected turn happens when there is a green arrow allowing you to safely proceed at a signal-controlled intersection. The green arrow indicates that any other traffic (cars, bicycles, pedestrians, etc.) that could somehow conflict with you is halted by red signals. Of course, once the arrow turns green, it is your duty to wait for any car, pedestrian or bicycle that may be still crossing or coming your way to pass.

can sm help i will give brainly thing for best answer. please help ​

Answers

D I think. Makes the most sense

In an experimental design, the ____________ variable is manipulated by the researcher, with the goal of eliciting a significant response. Here, this was accomplished by pairing words and syllables according to one of three word types. Then researchers measured the __________ variable by asking subjects to assess ________ for each syllable.

Answers

Complete question

1a. independent.b. dependent.2 a. dependent.b. independent.3 a. pleasantness rating.b. part of speech.

Answer:

1.independent,

2. dependent,

3. pleasantness rating

Explanation:

In an experimental design the independent variable or predictor variable is the variable that is usually manipulated by the researcher. Tis variables effect in the dependent/predicted variable is direct.

The dependent variable is the variable that is of interest, it is the variable that is being tested for.

Pleasantness rating is an independent variable that is used to measure effect on the dependent variable.

Choose all the answers that apply.
Comets are made of ___

dust
frozen gas
rock
Ice
water

Answers

Answer:

Explanation:

Comets are madeof  rock dust and ice

Answer:

Hello there :3 although all these are in a comet the major components are ice, dust, and rocks.

Explanation:

Hope this helps!

what does the Q stand for in LGBTQ

Answers

Answer: quack

Explanation:

Answer:

queer or questioning

Explanation:

i don't remember which

What elements of progress monitoring do you think are most important to making good educational decisions and why?​

Answers

Answer:

Important components of progress monitoring are:

Selecting evidence-based tools.

Implementing the assessment well.

Considering students' language barriers and special needs.

Recognizing students' strengths.

Which of the following was a 20th-century proponent of expressivism?
Group of answer choices

Mill

Calvin

Ayer

Dennett

Answers

The correct answer is C. Yesterday

Explanation

Alfred Jules Ayer (1910 - 1989) was a philosopher of English nationality who promoted the philosophical ideas of logical positivism and philosophical expressivism. This current of thought focused on the study of the meaning of moral language. Therefore, expressivism studies sentences that include moral concepts, because they argue those moral concepts do not express reality but rather express an evaluative attitude towards an object, that is, they are not true but can be considered just as an opinion.

Ben and Melissa, a married couple, agree that Melissa will share household duties such as cooking, cleaning, and washing equally.Also, since both partners are working, they decide to hire a fulltime babysitter for their one-year-old son.Which of the following steps in the process of learning marital roles and identity bargaining is seen in this scenario?
A) treating the partners as a friend
B) identifying with the roles
C) negotiating changes in their new roles
D) treating the partner as a confidant

Answers

Answer:

B

Explanation:

Which of these should you NOT do when there is a steady yellow traffic light?

A. Stop before you enter the intersection if you can do so safely.
B. Speed up to make sure you beat the light, even if it would be safer to stop.
C. If you're already in the intersection, clear it as quickly as possible while
maintaining safety
D. Proceed through the intersection only if it would be unsafe to stop.

Answers

Answer:

B. Speed up to make sure you beat the light, even if it would be safer to stop.

Explanation:



Which climate region is labeled with the letter F on the map above?

A. marine west coast
B. humid subtropical
C. Mediterranean
D. Arid​

Answers

Answer:

A. marine west coast sorry if it's wrong

Pretty sure it’s a.

Explanation: it’s west coast

find the value using the properties of integers

(-35)×98+(-35)×2​

Answers

-35×(-98) -35×{-( 100-2)} -35×{-100+2} -35×(-100)+(-35)×2 3500+(-70)

1. What was the role played by Rajendra Laxmi during the unification
campaign?

Answers

Answer:

Queen Regent Rajendra Rajya Lakshmi repelled the combined attacks of the Chaubise kings, and expanded Nepal's borders up to Kali Gandaki. She is viewed as an able administrator who extended King Prithvi Narayan Shah's military campaign.

Explanation:

The leading cause of air pollution is:

oil refining
iron and steal factories
exhaust from automobiles
waste from paper mills

Answers

I believe the answer is exhaust from automobiles

Which philosopher is associated with the ideas? Confucianism Daoism Legalism

Answers

Answer:

Kongzi for Confucianism, Han Feizi for Legalism and Zhuang for Daoism.

Explanation:

Confucius also known as Kongzi was a Chinese philosopher who formed and explained the philosophy of Confucianism who lived in the 6th century BCE. Philosopher Han Feizi developed the philosophy of Legalism in 280 - 233 BCE). He lived in the state of Qin which was an ancient Chinese state during the Zhou dynasty. The founder of Daoism philosophy is Laozi also known as Old Philosopher but philosopher Zhuang made great contribution to Daoism philosophy in the 4th Century BCE.

I will give Brainliestttt The variety of climate zones in Southern Africa creates
a. extreme weather conditions
c. long winters
b. poor growing conditions
d. biodiversity
Please select the best answer from the choices provided
ОА
B
a
C
O

Answers

Answer:

d. biodiversity

Explanation:

Which of these countries was taken by Germany in World War II?
Denmark
Phillipines
Ethiopia
Fiji

Answers

Answer:

Denmark

Explanation:

All the other countries were not in Europe. Germany conquered most of Europe, not other continents

Which roles are concerned with providing emotional support and encouragement to family members?

___________ roles are concerned with providing emotional support and encouragement to family members.

Fill in the blank.

Need help asap!

Answers

Answer:

Affective roles

Explanation:

There are two types of roles in a family

a) Instrumental roles - The role of an individual in a family is to provide physical resources such as basic necessities of life (food, clothing and shelter). The individual is also responsible for managing the family.

b) Affective roles - The role of an individual is to provide emotional support and encouragement

Which statement BEST describes rural population change in the countries listed in the graph?

A. Iceland became more urban.

B. The rural population is decreasing or remaining unchanged.

C. Portugal has the largest rural population total.

D. The rural population is increasing or remaining unchanged.

Answers

From my perspective the answer should be “D”

Why is Ramadan significant to Muslims?

Answers

Ramadan is a time of spiritual reflection, self-improvement, and heightened devotion and worship. ... Muslims believe that Ramadan teaches them to practice self-discipline, self-control, sacrifice, and empathy for those who are less fortunate, thus encouraging actions of generosity and compulsory charity (zakat).

Ramadan (pronounce it as "Ramzaan") is the month in which the Quran was revealed to Prophet Muhammad (S.A.W.) through the arch-angel Jibreel ("Gabriel" in the Bible).

Ramadan is the holiest month in the Islamic calendar. Muslims fast from sunrise to sunset for an entire month.

As one of the five pillars, or duties, of Islam, fasting during the month of Ramadan is mandatory for all healthy adult Muslims. However, there are certain exemptions.

"In Islam, there are several excuses for not fasting during Ramadan, including prepubertal children, women during their menstrual period or postnatal bleeding, travelers, pregnant or breastfeeding women, the elderly who cannot tolerate fasting, the mentally disabled and the sick whom fasting will aggravate their condition, or even patients with chronic medical conditions (eg- diabetes)"

But why is it so important?

It is more than just fasting!! Muslims must abstain from eating, drinking (even from drinking water), from doing immoral acts and from getting angry.

This also teaches us the importance of food and water, and make us think twice before we waste it. Not many people in this world are privileged to afford a square meal everyday.

Another pillar of Islam is Zakaat (charity), which is an obligatory form of alms-giving required of every able Muslim at the end of Ramadan (again this is not compulsory for everyone to donate fir charity, there are certain exemptions here too!). The purpose of Zakat al-Fitr is to enable poor people to celebrate Eid al-Fitr, the festival to break the fast of Ramadan.

So you can say, for Muslims, it is a time for piety and spirituality; in other words, an opportunity to get closer to Allah!

Thank you for reading :)

Name the form of government in which one person has all the power.

Answers

dictatorship is what I’m guessing

Answer:

Totalitarianism

Explanation:

Totalitarianism is a concept for a form of government or political system that prohibits opposition parties, restricts individual opposition to the state and its claims, and exercises an extremely high degree of control over public and private life. Which basically means one person in charge.

What's Ghana's environment protection bureau

Answers

The Environmental Protection Agency, (EPA Ghana) is an agency of Ministry of Environment, Science, Technology and Innovation, established by EPA Act 490 (1994). ... EPA Ghana's mission is to manage, protect and enhance the country's environment and seek common solutions to global environmental problems.

what is industry revolution​

Answers

Answer: The Industrial Revolution transformed economies that had been based on agriculture and handicrafts into economies based on large-scale industry, mechanized manufacturing, and the factory system. New machines, new power sources, and new ways of organizing work made existing industries more productive and efficient.

Which one of the following deaths would NOT necessitate an autopsy?


death of an ailing 86 year old woman

death of the victim at the Willow Lane scene

death of a 40 year old man at the scene of a robbery

death of a teenager in an automobile crash

Answers

Answer: the real answer is A: death of an ailing 86 year old women

Explanation:

got it right on my lesson

Answer:

A. death of an ailing 86 year old woman

Explanation:


QUESTION 4
Which of the following is a deductively sound argument?
O Cars are vehicles and vehicles are machines. So, cars are machines
O Motorbikes are vehicles and vehicles are made of metal. So, motorbikes are made of metal
O Cars are vehicles and motorbikes are vehicles. So, cars are motorbikes
O Motorbikes are made of metal. So, motorbikes are machines
Click Save and Submit to save and submit. Click Save All Answers to save all answers.
MacBook Air

Answers

pretty sure number 1, vehicles are complex machines based on dictionary definition

Give an example on how each branch of government can "check" the power of another branch.

Answers

The legislative branch makes laws, but the President in the executive branch can veto those laws with a Presidential Veto. The legislative branch makes laws, but the judicial branch can declare those laws unconstitutional.

Based on research findings on attribution styles, complete each sentence with: "situational" or "dispositional" to describe the most likely attribution an example of what that attribution might be. Example: I give $100 to charity every year. Dispositional: According to the self-serving bias, I attribute my own admirable actions to my own good reasons. I give $100 because I am generous and look out for others

Answers

Answer:

1) I give $100 to charity every year.---- dispositional

2) According to the self-serving bias, I attribute my own admirable actions to my own good reasons.---- situational

3) I give $100 because I am generous and look out for others---dispositional

Explanation:

Situational attribution refers to the process of allocate the cause of behavior to the situation outside the control of an individual rather than internal characteristic whereas, dispositional attribution refers to allocate the cause of behavior of an individual due to internal characteristic of a person and not due to outside forces. For example, ''I give $100 because I am generous and look out for others''. is refers to the dispositional attribution because it occurs from internal characteristics of the individual whereas the second sentence is situational attribution.

Daoist ethics are based on which of the following?

a) The Dao will punish you if you hurt others, including nature and animals.

b) Since you are interconnected with all things, if you harm something, you are harming yourself, and eventually you will suffer the natural consequences Therefore, it is in your own best interests not to harm anyone or anything

c) If you do good things, the Dao will reward you.

d) If you do good things you will go to Daoist heaven after you die.​

Answers

Answer: I think it might be b

PLEASE PLEASE HELP!! IT WOULD MEAN A LOTTT

Answers

Answer:

Mexico

Explanation:

()

Other Questions
What is the value of X in the equation. X- 4.3 = 2.5 Why were Julius and Ethel Rosenberg convicted of treason?They were proven to be spying for the USSR.They tried to attack the US with nuclear weapons.They brought USSR secrets to the US government.They wanted to leave the US to go live in the USSR. Which of the following is a true statement? A. Disruptions in an ecosystem are normal and natural changes.B. Disruptions in an ecosystem are caused by both human activity and environmental disturbances. C. Ecosystems are complex, interactive systems that include both biotic and abiotic components of the environment. D. All of these are true statements. A cylindrical soup can has a radius of 1.1 in. and is 5.4 in. tall. Find the volume of the can and round to the nearest tenths if necessary PLS HELP ASAP WILL MARK BRAINLY!!!. In a bag there are 3 red marbles, 2 yellow marbles and 1 blue marble. After a marble is selected, it is replaced. After 40 attempts at drawing two marbles from the bag, there were three instances where a blue marble then a yellow marble was pulled. What is the experimental probability of pulling a blue marble and then a yellow marble? 0.0556 0.0750 0.0167 0.0333 How do I find the next four of the sequence? Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY Which equation can be used to solve for x in the following diagram?150102 Marcys breakfast table has a square table top with an area of 36 square feet. What is the approximate diagonal length of the table top? Round to the nearest tenth. Figure out length in inches for brainiest and 5 stars. ZABD and ZDBC are supplementary angles.What is the measure of x?x = [?]7DAT110%B>CAngles are not drawn to scale.Enter The number of blueberry muffins made is 40% of the total number of total muffins they make daily. On tueday, the baker makes 60 muffins. How many miffins does the Baker bakes on Tuesday? easy algebra question below first correct answer gets brainliest, if you put one of those links you will get reported and blocked Which value of x makes the inequality -* < 8 true?AX = 32BX = 35x = 34D= 2