Factor 6d2−21d...The factored polynomial is _

Answers

Answer 1

Answer:

Then find the product of the common prime factors. 42 = 2 ⋅3 ⋅7. 70 = 2 ⋅5 ⋅7 ... 6d2 − 21d. 27. 3y3 − 9y2. 28. 20x3 + 30x2. 29.


Related Questions

How do you graph x<0

Answers

Answer:

x < 0 is every point going from -1 to -∞, so it’s basically a block with infinite height and width going from -1 to -∞

Hope this helps!

An isotope of cesium-137 has a half-life of 30 years. If 5.5 grams of cesium-137 disintigrates over a period of 105 years, how many grams of cesium-137 would remain? Round your answer to the thousandths place.

Answers

Answer:

0.484 g

Step-by-step explanation:

N/No = (1/2)^t/t1/2

No = mass of cesium-137 originally present

N= mass of cesium-137 at time t

t1/2= half life of cesium-137

t = time taken

N/5.5=(1/2)^105/30

N/5.5=(1/2)^3.5

N/5.5= 0.088

N = 5.5 *  0.088

N= 0.484 g

Find the value for m
-10 + 59 = 5m = 7 + 3m

Answers

-10+59=5m=7+3m
-49= 5m=7+3m
5m=56+3m
2m=56
m=28

If x=5 and y=−2, evaluate the following expression:20−5y+2x​

Answers

Step-by-step explanation:

20−5y+2x

20-5(-2)+2(5)

20+10+10=40

Answer:

20 − ( 5 ) ( −2 ) + ( 2 ) ( 5 )

= 20 − ( −10 ) + ( 2 ) ( 5 )

= 30 + ( 2 ) ( 5 )

= 30 + 10

= 40

Hope it helps

Please mark me as the brainliest

Thank you

I don't know anything about this. please explain what this means and how to do it. ​

Answers

Answer:

90

Step-by-step explanation:

you have to multiply A B and C and you should get 90

i think i'm right

The sum of 3 times a number and another number is 10. The bigger number is 5 more than 2 times the smaller number. What are the numbers?

Answers

Answer:

7 and 1

Step-by-step explanation:

NOWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW

Answers

Answer: 60 is the answer.

Step-by-step explanation: We can use the total sum, 180.

To get the missing angle, add the 2 angles, 60 and 60.

60 + 60 = 120.

Then subtract from 180.

180 - 120 = 60.

Hence, 60 is the answer.

Let me know if you have any questions.

~ Lily, from Brainly.

Note to asker: Write this down!

To find 1 missing angle:

A1 + A2 = TA - 180 = X (A1 = Angle1)

Serenity has a toy car collection. She keeps some in a display case and the rest on the
wall.
104
of her toy cars are on the wall, and 74% of her toy cars are in the display
case. What is the total number of toy cars in Serenity's collection?

Answers

If 74% are in the display, then 100% - 74% = 26% are hung on the wall.

This means 104 cars is 26% of her collection.

To find the total collection divide the number on the wall by the percentage of the collection:

104/0.26 = 400

The total number of her collection is 400 cars.

Irri is traveling in a group of 888 cat warriors. Each cat needs 444 liters of milk per day to maintain good morale. Mirri has a supply of 969696 liters of milk. Another cat has enough milk to last for 222 days. Which equation can we use to find \greenD{d}dstart color #1fab54, d, end color #1fab54, the total number of days the milk will last?

Answers

Answer:

3.25 days

Step-by-step explanation:

Irri is traveling in a group of 8 cat warriors. Each cat needs 4 liters of milk per day to maintain good morale.

The total number of liters for the cat is calculated as:

8 × 4 liters of milk

= 32 liters of milk.

Another cat has enough milk to last for 2days.

= 4 liters of milk × 2 days

= 8 liters

Mirri has a supply of 96 liters of milk.

Total liters of milk = 96 liters + 8 liters

= 104 liters

Which equation can we use to find the total number of days the milk will last?

This is calculated as:

= 104 liters/32 liters

= 3.25 days

Which expression represents all the solutions to the inequality
3(2x - 8) > 4x + 26?

Answers

Answer:

x > 25

Step-by-step explanation:

3(2x−8)>4x+26

Step 1: Simplify both sides of the inequality.

6x−24>4x+26

Step 2: Subtract 4x from both sides.

6x−24−4x>4x+26−4x

2x−24>26

Step 3: Add 24 to both sides.

2x−24+24>26+24

2x>50

Step 4: Divide both sides by 2.

2x

2

>

50

2

x>25

a. Keiko's estimate for the distance the car will roll is 85 cm. What is the percent error in Keiko's estimate? Show your work.​

Answers

Answer:

I believe it should be 5.882%

Step-by-step explanation:

This is how i got tought to do it

85-80=5

5/85=0.05882

0.05882 times 100=5.882%

and that's your answer hope you get it right.

PLEASE HELP ASAP!

:(

Answers

Answer:

hit the square

Step-by-step explanation:

I'm pretty sure you have to hit the square and then that would be number two

find each measure (EH)

Answers

Answer:

five hundred yessirhjtffg

How can i Round this answer to the nearest tenth?

11.8

Answers

9514 1404 393

Answer:

  11.8

Step-by-step explanation:

The number has no digits to the right of the tenths place, so the number is correctly rounded as is.

  11.8

HELP SOMEONE PLEASE. please please ): For geometry.

Answers

Answer:8

Step-by-step explanation:

Percy collects baseball cards and has been saving his money to buy some new ones. He finds 13 cards online that each
cost the same amount of money, plus a one-time $8 shipping fee. Percy starts with $286, and after he places his order,
he has $182.06 left over. How much did each card cost?
Show the equation you used to find your answer and label what each part of the equation represents

Answers

Answer:

$7.38

Step-by-step explanation:

Let's start out with variable x, representing his original $286

y will represent his balance after his order ($182.06)

a is our variable for our one-time $8 shipping fee

b will represent the cost of one card

our equation is => ((x - a) - y) ÷ 13 = b

Substitute => ((286 - 8) - 182.06) ÷ 13 = b

Solve => (278 - 182.06) ÷ 13 = b

95.94 ÷ 13 = b

b = 7.38

Thus, our answer is $7.38 per card

Solve inequities :
1. )x−2 > −6
2. )35 > −6
3. )3.5n ≤ 7
4. )10 ≤ x+7

Answers

Answer:

1, x> -4

2, True

[tex]3.n \leqslant 2[/tex]

[tex]4. 3 \leqslant x[/tex]

On a snowy winter's eve, two candles are lit at the exact same time. A 18-inch candle and a 21-inch
candle are lit at the exact same time. The 18-inch candle burns 2 inches every hour. The 21-inch
candle burns 3 inches every hour.

Answers

25 more minutes the candle was burning

4x + 7 = ? (I'm not so good in math so please help)

Answers

Answer:

4(x+ 1.75)

Step-by-step explanation:

Answer: 4

i wish that helped

Which of the following is the correct mapping for shape A and shape B?

Answers

Answer:

b. (x , y) -> (-x , y)

Step-by-step explanation:

Reflection over y axis

hi please help i’ll give brainliest please

Answers

Answer:

45

Step-by-step explanation:

The answer would be 45

Please Help
please and thank you!

Answers

Answer:

Step-by-step explanation:

cube means 3D  square.. right?

so for volume  we want the height x width x length.. make sense?

since each edge is 9'  

the volume is [tex]9^{3}[/tex] = 729  [tex]ft^{3}[/tex]

Answer: 729

Step-by-step explanation:

This is very simple all you do is cube 9

[tex]9^{3}\\729[/tex]

Make a table of values with the equation provided. Thanks! :)

Answers

Answer:

The answer is in the picture, good luck :)

Step-by-step explanation:

Is the answer I pick right

Answers

Answer:

Yes

Step-by-step explanation:

Find the area of the polygon.




Need help ASAP. Will give brainliest if possible. :)

Answers

Answer:

[tex](30 \times 30) + ( \frac{1}{2} \times (30 + 15) \times 30 \\ 900 + 675 \\ 1575[/tex]

What's the distance between -19 and 82?

Answers

I think its 101 maybe

Answer:

101

Step-by-step explanation:

Solve the right triangle
Using trigonometry

Answers

Answer:

f is 14 And 8 is E

Step-by-step explanation:

so you have to solve the first step of 14 and 8 it is 90 dress angle

Figure ZANY is a square. If ZY = 7x - 3 and ZA = 6x, what is the value of x

Answers

7x-3=6x
x=3
..........

I am stugling with algebra (because of zoom classes) and have multiple questions, please answer as many as you can. Thank you!
3x + 7 = 4x X=
x + 2 + 2x = x + 10 X=
x + 3x = x + x + 10 X=
2x + 3 + 3x = x + 11 X=
(oh and PLEASE explain this to me!)

Answers

9514 1404 393

Answer:

x = 7x = 4x = 5x = 2

Step-by-step explanation:

The general steps are ...

look at what you haverewrite the equation so the variable terms are on one side and the constant terms are on the other side of the equal sign; collect termsdivide by the coefficient of the variable

It is generally convenient to put the variable terms on the side of the equation having the largest (most positive) variable term. You do the rearranging by subtracting the terms you don't want. Any operation is performed on both sides of the equation.

__

1) 3x + 7 = 4x

We observe the largest x-term is on the right, and the only constant term is on the left. We can subtract the x-term 3x to eliminate it from the left side

  3x +7 -3x = 4x -3x

Combining like terms gives ...

  7 = x . . . . . this is the solution

__

2) x +2 +2x = x + 10

We observe x-terms and constants on both sides of the equation. First of all, we will combine like terms.

  3x +2 = x +10

The largest x-term is on the left, so we choose to subtract x (the x-term on the right)

  3x -x +2 = x -x +10

  2x +2 = 10

We don't want the constant on the left, so we subtract 2.

  2x +2 -2 = 10 -2

  2x = 8 . . . . . . . . . . combine like terms

Now, we divide by the coefficient of x.

  2x/2 = 8/2

  x = 4 . . . . . . the solution

__

3) x +3x = x + x + 10

  4x = 2x +10 . . . . . . . combine like terms

  2x = 10 . . . . . . . . . . . subtract 2x

  x = 5 . . . . . . . . . . . . . divide by 2

__

4) 2x +3 + 3x = x + 11

  5x +3 = x +11 . . . . . . . . combine like terms

  4x +3 = 11 . . . . . . . . . . . subtract x

  4x = 8 . . . . . . . . . . . . . . subtract 3

  x = 2 . . . . . . . . . . . . . . .divide by 4

_____

Learn to identify and combine like terms. Use addition or subtraction to eliminate terms you don't want. Use multiplication or division to eliminate coefficients you don't want. Whatever you do to one side of the equation must also be done to the other side of the equation. (In the above, we use "subtract ..." to mean "subtract ... from both sides of the equation," for example.)

Find the surface area of the regular pyramid.
14 cm
11 cm

Answers

Answer: you on this to

Step-by-step explanation:

Other Questions
Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks. If 2 cups makes 6 servings, how much makes 2 servings? shawtys been simping for so long.. do you think hunter-gatherers are still around today? what makes you think that? Hi, I am very stuck on questions 17 and 18. Can someone help please? Thanks In which quadrant does the point with c ordinate (4, -3) lie? Which student has the greater median test score? I have to study for a test. It's for data management. Does anyone have tips? (Grade 7) PLEASE HELP ME WITH ALGEBRA! THANK YOU Explain how Japan took control of Manchuria. This is worth 16 points if you show work you will get the Brainliest answer if your unable to show work type it for your explanation plz ( no links ) How was the celebration of St. Patrick's Day connected to Ireland's struggle for nationhood? Plzz Help due today!!!