Explain the change of color that often occurs in leaves in the autumn in simple terms.

Answers

Answer 1

Answer:

In autumn when it starts to get cold, some plants stop making chlorophyll. Instead, those plants break down chlorophyll into smaller molecules. As chlorophyll goes away, other pigments start to show their colors. This is why leaves turn yellow or red in fall.

Explanation:


Related Questions

__________ is a method of wood harvesting that clears trees in an area in two or three cuts over several years.
A)
Seed-tree cutting
B)
Parthenocarpy
C)
Shelterwood cutting
D)
Selective cutting
E)
Clearcutting

Answers

Answer: E

Explanation: clearcutting

I believe the correct answer is E. Clear-cutting

Drag the tiles to the correct boxes to complete the pairs.
Match the mRNA sequences to their DNA sequences.

Answers

1.) UUUUUAACG
2.) CCGAAAUGU
3.) AUUACGCAU
4.) GAUCAUUAC

What is true about the insanity defense?

It is defined in the Diagnostic and Statistical Manual of Mental Disorders.
It can be used only if a person is diagnosed with a specific disorder from the DSM.
It is a legal term used to determine if a person can be held accountable for a crime.
It is a legal term that helps to determine if a person committed a crime or not.
It cannot be used if a person was previously found to be responsible for a different crime.

Answers

It is a legal term used to determine if a person can be held accountable for a crime

It's a legal term used to determine if a person can be held accountable for a crime. Hope this helps; have a wonderful day.

PLS HELP!!!! 10PTS

Reproduction is not a life process still organisms spend a lot of energy on it. Give reason.

Answers

To keep their bloodline running.

Answer:

Reproduction is not a life process, but still organisms spend a lot of energy on it. ... The reproduction is not necessary to ensure living but it is required to ensure that the continuation of the living organisms and generations of the next cycle of living. It is necessary for ensuring the stability of the population.

Reproduction also helps in increasing the population of the species. All the processes which are necessary to maintain life in an organism are called life processes. Reproduction is not considered a life process because it is not necessary to maintain life.

If water is polar, state a liquid that you think is nonpolar, and justify your answer

Answers

A gas. This is because none polar solvents contain binds between atoms with similar electronegativities, some examples are carbon and hydrogen

Soil erosion can be BEST prevented by

- Heavily watering the vegetation on the slope

- Increasing the slope of the land by adding more soil

- Building terraces into the sides of a slope

- removing grass from the steepest slope.

I need help!!

Answers

Answer: Following are some of the methods of soil erosion prevention: Plant trees on barren lands to limit erosion of soil. Add mulch and rocks to prevent the plants and grass underneath to prevent soil erosion. Mulch matting can be used to reduce erosion on the slopes.

Answer:

Building terraces into the sides of a slope

I HAVE BEEN STUCK HERE FOR 5 MINUTES...!

Answers

vague repetitive pictures

Answer:

Should be C

Explanation:

D is wrong because standing out should mean they are spotted more easily, which means they get hunted down more often/ prey spot them easier

B is kind of weird because larger population = more competition, and I remember owls work alone

A is suspicious because they are both tawny owls and I don't understand how less food they need to be significant

C sounds plausible because the gray feather can be a "stronger" gene or something

why cant you touch your palm to your shoulder? (on the same arm)

Answers

Answer: cause

Explanation:

Some people can some cant

Some people are left handed and some people are right handed

The energy produced by respiration is the in the form of adenosine triphosphate or ____________​

Answers

Answer:

ATP

Explanation:

Adenosine triphosphate

1) How is nondisjunction related to Down syndrome and other abnormal chromosome numbers?

2) State the differences between DNA and RNA

Pleaaseeee helllpppp :(((

Answers

1. Down syndrome is usually caused by an error in cell division called “nondisjunction.” Nondisjunction results in an embryo with three copies of chromosome 21 instead of the usual two. Prior to or at conception, a pair of 21st chromosomes in either the sperm or the egg fails to separate.


2. DNA contains the sugar deoxyribose, while RNA contains the sugar ribose.


DNA is a double-stranded molecule, while RNA is a single-stranded molecule.

Choose either one ^^^

Hope this helps you.

What form of energy is responsible for producing changes that occur in Earth’s hydrosphere?

Answers

Answer:

the sun because energy from the Sun heats the Earth unevenly. As a result, convection currents develop in the atmosphere and ocean. These redistribute heat in the atmosphere and oceans.

Answer: Hydropower is created when rapidly flowing water turns turbines inside a dam, generating electricity. Nuclear energy is produced at power plants by the process of nuclear fission. The energy created during nuclear reactions is harnessed to produce electricity.

PLEASE MARK ME BRAINLIST

If a cell has 40% solute and is placed in a solution with 60% water what will happen to the cell

Answers

There will be no net movement of water in or out of the cell.

Water moves out of the cell when a cell is placed in a hypertonic solution. This is a solution that contains more solute than does the cell. When a cell is placed in a hypotonic solution, water enters into the cell from the solution until the cell finally bursts. However, if the cell and the solution contain the same amount of solute, there is no net movement in or out of the cell.

We can see here that the cell has 40% solute and is placed inside a solution that has 60% water. This means that the solution also contains 40% solute. There will be no net movement of water in or out of the cell.

Learn more: https://brainly.com/question/2673886

Mitosis and budding are similar beu
O
Both processes are components of sexual reproduction
The offspring produced by both are genetically diverse
In both, the genetic material comes from a single parent.
O O
Both processes are more common in animals than in plants.

Answers

Answer:

animals would be your awnser you are welcome  

Explanation:

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Which component of the endomembrane system is responsible for packaging and preparing exist proteins in vesticles?

Answers

Answer: Golgi apparatus

Explanation: The Golgi is responsible for packaging sorting tagging and distribution.

Hope this is helpful :)

can someone write me a essay of Photosynthesis for 30 points URGENT!!! It has to be highschool level

Answers

Answer:

Here, I got u homie!

Explanation:

Photosynthesis is the process through which green plants and other specific living organisms utilize light energy to convert water and carbon dioxide in to simple sugars. Through photosynthesis, green plants are able to manufacture their own food which is essential for their growth.

Plz give brainliest

Which of the following is not a premise of Cell Theory?
l. All cells arise from other cells.
ll. All living cells require water for survival.
lll. All living things are only composed of cells.
Choose 1 answer:
a. I only
b. ll and lll
c. ll only
d. lll only

Answers

All cellsarisefromothercells a I only

What is a complex Sugar? Please a specific answer(make more sense)

Answers

Answer:

Complex carbohydrates are MADE up of sugar molecules that are strung together in long complex chains, complex carbohydrates are found in food like peas, beans, whole grains and vegetables.

Explanation:

Both SIMPLE and COMPLEX carbohydrates are turned into glucose (blood sugar) in the body and are used as energy.

I really hoped this helped some, I tried to make it specific :[

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

Answer fast please. !!!!!!!!!!!!!!!!!!A geologist who needs to curricula to rock formations in different areas can match exposed rock layers
true or false

Answers

Answer:

A geologist who needed to correlate two rock formations in different areas could match exposed rock layers? A geologist who needed to correlate two rock formations in different areas could match exposed rock layers. TRUE.Explanation:

Answer:

true

Explanation:

HELP ME WITH THIS PLEASE I REALLY NEED HELP I WILL GIVE U BRAINLY IF U GET IT RIGHT !!

Answers

The answer is b because it prey wouldn’t be able to eat it

Please help due in 10 minutes!
Explain how genetic drift of alleles in a small population- and- describe 2 real world examples of genetic drift (I.e. The Founder Effect and The Bottleneck Effect)

Answers

Answer:A small population is formed with a larger population.

Explanation:The population don’t represent the genetic diversity’s of the original

Population, and there smaller size mean they may experience strong drift of generations.

What does the brain stem do?

Answers

Help you out with anything you’re having trouble with

Answer:

It connects the rest of the brain to the spinal cord, which runs down your neck and back. The brain stem is in charge of all the functions your body needs to stay alive, like breathing air, digesting food, and circulating blood.

Explanation:

as a result of fertilization_____is formed​

Answers

Answer:

zygote

Explanation:

Fertilization is the process in which haploid gametes fuse to form a diploid cell called a zygote. To ensure that each zygote has the correct number of chromosomes, only one sperm can fuse with one egg.

thinks mrs. Clack that finned tetrapods developed "hands" before or after migrating to land​

Answers

Big fat juicy titsdood

Answer:

what am i supposed to anwser? should I prove her wrong?

Explanation:

which phase best describes meiosis I? ​

Answers

Answer:

Division of homologous chromosomes.

I hope it's helpful!

A dichotomouys key is used to identify a plant. 1a. Leaves are spiny ......................Pinus taeda 1b. Leaves are broad..................... Go to 2 2a. Single leaf..........................Go to 3 2b. Many leaves....................... Go to 4 3a. Leaf edge is smooth..............Cornus florida 3b. Lead edge is rough...............Ulmus americana 4a. Leaflet edges are smooth........Albizia julibrissin 4b. Leaflet edges are rough.........Juglans nigra A plant has many broad leaves with rough edges. What type of plant is this? (1 point)

albizia julibrissin
pinus taeda
cornus florida
juglans nigra

Answers

Answer:

juglans nigra

Explanation:

I did my research and its correct I finished the quiz

1 B

2 C

3 D

4 C

5 A

The plant identified by the dichotomous key is juglans nigra.

What is a dichotomous key?

A dichotomous key is a tool used to identify any plants and animals in the ecosystem.

They are identified by their morphological traits.

The key is made up of a set of paired assertions or clues about the qualities or attributes of the organisms.

It serves as a step-by-step guide to identifying each object.

Thus, the correct option is D, juglans nigra.

Learn more about the dichotomous key, here:

https://brainly.com/question/25244481

There is the picture to the question

Answers

Answer:

DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD

                                                                               

Kerstin is getting ready to graduate high school. She wants to become a cardiac perfusionist. Which best describes the path she should take to her career?

Answers

Answer:

four-year degree , master’s degree , certification exam from ABCP

Explanation:

Answer:

She should do a four-year degree , master’s degree , certification exam from ABCP

Explanation:

Why would the atomic number be better to identify an element than the atomic mass?

Answers

Answer:

because the atomic number tells you how many protons and neutrons there are

Explanation:

Other Questions
George wants to buy a new television that is on sale for 1/4 off the regular price of $599.96. The sales tax is 7%. What is the final price of the television including tax? Which North American country is most like the place that you live in terms of its physical characteristics? In 3 to 5sentences, describe the reasons for your choice. What is the function of stanza 4 in the structure and message in the poem? (To his excellency, general washington) The measures of the angles of a triangle are shown in the figure below.Solve for X what is the measure that is complementary to an 20 degree angle Why did people want to fight in ww1? Zach is a high school student who has an after school job at a grocery store. How much will he earn if he earns 75$ a week for 5 weeks? White light is an _____________ mixture of all the colors.a) observable b) unequal c) equal Which is an acceptable Lewis structure for a diatomic nitrogen molecule?OA NENOB.NNO C.:NN:OD.NENOENEN 1 The Fifth Amendment to the Constitution provides protection from self-incrimination. What does self-incrimination mean?2 Even though citizens have specific rights which the government may not take away, these rights may have certain limits. What are some examples of the limits? 3 Which liberty is guaranteed by the First Amendment?4 The right of the people to express their political views is protected in our government by which amendment. 5 The 19th Amendment and the 26th Amendment were both designed to6 While people have the right to protest against war, they also have the legal obligation to protest how? 7 During the French and Indian War, colonists were required by law to house any British soldier or soldiers who asked for a place to stay. The colonial rejection of this practice is clearly seen in which Amendment in the Bill of Rights?8 Samuel has been criticizing the policies of the state government, which has led law enforcement officials to conduct a raid on his home. 9 He could be protected, though, by which Constitutional Amendment?10 What is the purpose of the United States Bill of Rights?11 What is "unalienable" right of a U.S. citizen according to the Bill of Rights?12 When it was created, the Fourteenth Amendment to the Constitution ensured rights for who 13 Which is an example of something outlawed by the Fourteenth Amendment?14 What does the first amendment protect? 15 The use of "poll taxes" as a means of racial discrimination was MOST effectively stopped by which methods?16 According to the ideals of government as espoused by the Enlightenment, all citizens have the right to life, liberty, and property. These rights are known as17 Be familiar with amendments 4,5,6,7,8 when it comes to the rights of the accused.18 What is double jeopardy? 19 If the government passed a law that required people to pay a tax in order to go to a worship service, which amendment would be violated?20 The Fifteenth Amendment to the US Constitution was intended to grant voting rights to which group?21 Which Amendment gave citizenship to all people born in the U.S.?22 How did the 26th Amendment expand voting rights?PLS ANSWER ONE AND NUMBER IT :) Jacob has 3 times as many football cards as Eli. Eli has 39 football cards. Tara has 111 football cards. Who has more football cards, Jacob or Tara? How many more? que es un nexo???reprobare :'v Q3: Create a class called Employee that includes three instance variablesa first name (typeString), a last name (type String) and a monthly salary (double). Provide a constructor that initializesthe three instance variables. Provide a set and a get method for each instance variable. If the monthly salary is not positive, do not set its value. {Do not write a full program, only a class} In Line 16 of his poem "The Road Not Taken," why does Frost say "I shall be telling this with a sigh? A When Frost tells the story in the future he will sigh a lot. B. Frost spent a long time making his decision of what road to take C. Frost has misgivings about the road he chose can you help me with my question as soon as possible A cookie factory uses 1/3 of a bag of flour in each batch of cookies. The factory used 2/3 of a bag of flour yesterday. How many batches of cookies did the factory make?Please Help PLEASEEE HELPPPP!!!!!!!! Which was a weakness according to the Articles of Confederation?a. Congress required a majority (7 out of 13) topass any new law.b. Congress was allowed to raise an army in timesof need, whether the states agreed with it or not.Congress was also expected to pay the states forthe soldiers.d. A majority of power stayed with the federalgovernment. Basically, if states needed anything,they had to ask the federal government for it.c. Congress could not regulate trade betweenstates and states were printing their own money. How many laces are on a football What is the evidence that depression can be linked to genetic as well as environmental factors?a.All individuals in similar stressful environments do not experience depression.b.All individuals with the gene variation tied to depression do not experience depression.c.Individuals with a combination of environmental stress and gene variation are more likely to experience depression.d.All of the abovePlease select the best answer from the choices providedABCD number 14 please and thank u