ES CURABLE LA CLAMIDIA

Answers

Answer 1
Yes with proper medication clamidia is treatable

Related Questions

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

Select the correct answer.
There was an overuse of fertilizers in William's farm. This led to the destruction of the crops, and William incurred huge losses. Which
management function was neglected in this process?
OA. organizing
OB. staffing
OC. planning
OD directing
O E. controlling

Answers

Answer:

OB. staffing

Which of the following cells would be found in connective tissue?


Osteocytes


Goblet cells


Mucous cells


Neuroglial cells

Answers

Explanation:

the common cell types in connective tissue include: fibroblasts, mast cells, plasma cells, macrophages, adipocytes, and leukocytes. Slide 72 Tendon. Fibroblasts are the most common cell type of connective tissue. They produce both fibers and amorphous ground substance.

Which statement describes the proper procedure for identifying an organism by using a dichotomous key?

Answers

Explanation:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts".

Over time, data that support the successful evolution of a species would include observations that describe

Answers

More body cells and more genetic changes happening

Help please! I haven't read The Immortal Life of Hennrietta Lacks and need help with this! Due today!

Answers

I honestly don’t know what book this is but I will read it it’ll prolly take 3 hours but I’ll come back

Which of the following is/are true about energy? (Select all that apply)
energy is only found in fuels
energy cannot be recycled
energy is never destroyed
energy changes form

Answers

Answer:

1 is wrong. 2 is right. 3 is true. 4 is true.

Explanation:

Energy can never be destroyed.

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

To review, what are the three main types of symbiotic relationships?
A. mutualism. commensalism, and parasitism

B. mutualism, community, practice

C. membership, commensalism, property

Answers

Answer:

A

Explanation:

The three main types of symbiotic relationships are mutualism, commensalism and parasitism

is the A is the one that has the most logic to your question

GIVING AWAY 14 POINTS PLEASE HELP ME ON THIS QUESTION ASAP!!!!

Answers

Answer: i think its B or C

Answer: B

Explanation: Hope this help :D

List one way that mitosis and meiosis are similar
and 1 way they are different.

Answers

The difference they have is mitosis produces two daughter cells with the same number of chromosomes as a parent cells. How they are alike is they are two type of cell divisions and associated with cytokinesis.

8 amino acide are coded by _______ amino acids?

Answers

Answer:

Explanation:

nutrients i think im not sure sorry sweetheart

hello please help i’ll give brainliest

Answers

Atmosphere is the correct answer!

Answer: Atmosphere

Explanation: It isthe envelope of gases surrounding the earth and protect it

The antlion is a ______

Answers

Explanation:

Antlion, (family Myrmeleontidae), any of a group of insects (order Neuroptera) that are named for the predatory nature of the larva, which trap ants and other small insects in pits dug into the ground. Antlions are found throughout the world, primarily in dry, sandy regions.

A morning glory has a {BLANK}
form of corona.

Answers

Answer:

I think the answer is

A morning glory has a risen form of corona

If all grasshoppers are removed from the food chain, what will happen to the blue birds

Answers

Answer:  If all grasshoppers are removed from the food chain, what will happen to the bluebirds? ... The bluebirds will begin eating more plants.

Explanation:

Answer:

If all grasshoppers are removed from the food chain...the bluebirds will decrease in numbers.

Explanation:

I hope that this has helped you to understand your question. If you have any further questions, please put them below.

Have a great rest of your day/night!

¿Cual es la importancia biológica de los estímulos umbrales?

Answers

Answer:

En electrofisiología, el potencial umbral es el nivel crítico al que debe despolarizarse un potencial de membrana para iniciar un potencial de acción.

Explanation:

En neurociencia, los potenciales de umbral son necesarios para regular y propagar la señalización tanto en el sistema nervioso central (SNC) como en el sistema nervioso periférico (SNP).

Espero que esto ayude :))

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

The five factors that can lead to evolution are gene flow, genetic drift, mutation, natural selection, and __________.

emigration
immigration
sexual selection
controlled mating

Answers

Explanation:

controlled mating is the correct one.

Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

The answer would most likely be whales

Answer:

whales

Explanation:

An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?

Answers

Answer:

True

Explanation:

As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.

Hence, the given statement is true

True or False? When populations of the same species are isolated from each other, they are more likely to become two separate species.

Answers

i believe it is true
If haves to be true

20 POINTS!!!
PLEASE HELP
lmk if you can’t read!

Answers

Answer:

1. Flinch eats the Sun's energy.

2. Fox

3. 6

4. The snake is a secondary predator, while the flinch is a producer.

5. The fox and (bird next to fox name)

Explanation:

Which of the following is evidence that cells no longer respond to external factors and may have turned cancerous?

A. New cells replace old or damaged cells.
B. Cell clumps form, crowding existing cells.
C. Dead cells are shed at a more rapid rate.
D. Dormant cells re-enter an active cell cycle.

Answers

Answer:

option C will be the correct answer

Dead cells are shed at a more rapid rate is evidence that cells no longer respond to external factors and may have turned cancerous.

What are the cancer cells?

Cancer cells are defined as cells which divide continually, forming solid tumors or flooding the blood with abnormal cells. Cell division is a normal process used by the body for growth and repair.

Sometimes this orderly process breaks down, and abnormal or damaged cells grow and multiply when they shouldn’t. These cells may form tumors, which are lumps of tissue.

For more information regarding cancer cells, visit:

https://brainly.com/question/373177

#SPJ2


a. What information could be useful to include in a warning on an e-cigarette ad?

Answers

Maybe the dangers that e-cigarettes can have. A warning that they’re addictive and contain nicotine.

A man is HH for a trait, while his wife is hh. What will their children

Answers

Explanation:

I hope what I have drawn on the picture will help you understand:)

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

Differences found in offspring?

Answers

Answer:

Chromazones

Explanation:

The answer is… Genetic variation can be caused by mutation (which can create entirely new alleles in a population), random mating, random fertilization, and recombination between homologous chromosomes during meiosis (which reshuffles alleles within an organism's offspring).
Other Questions
The water cycle: 1. Name three important needs for water biomechanical mechanisms, habitat for plants and animals, participate in cycling of all materials used by living things 2. How is water distributed through the biosphere Which expression is equivalent to-3(m+5)A.) m - 15B.) -3m + 5C.) -3m - 15D.) -15m find the volume of a rectangular pyramid with a base of 2 meters by 6 meters and a height of 3 meters (no photo attached) Is 1/4 squared a rational? Please help this is Science. Which of the dictators came to power first?a.Mussolinic.Hitlerb.Stalind.cannot tell from table No links, please. Ill give brainiest What is the area of a trapezoid that has the following dimensions? b: 45 mm bz: 37 mm h: 6 mm 2 A= Whats the answer in factor 5x + 5 = Why is the right to vote important? What 100-day event is Mark Doyle referencing? *World War IIRwandan genocideWar in IraqGang conflict in Los Angeles I need help on this one!!! The picture shows an investigation conducted by Galileo many years ago. He learned that the speed of each ball increased as it fell, and that the balls fell at the same average speed. image Which of these statements is best supported by Galileos investigation? GIVING BRAIN TO CORRECT ANSWER!Leanne is writing an essay with the following claim: "Students who participate in after-school sports should be given PE class credit for each sport they play." Which statement should Leanne include in her essay to best anticipate and respond to a counterclaim to her argument?A.) Teachers may argue that even Students who participate in after-school theatrics need some physical activity in order to stay focused during the school's day, but students' needs for activity differ, so students should be able to choose for themselves when to exercise.B.) It could be argued that PE classes are an important investment in the health of our children, but many students would like to have a free period during the school day.C.) Some may argue that it will be too difficult to arrange a system to give PE credit for after-school athletics and that it will be too easy for students to fake or lie about their participation in order to avoid doing any physical activity at all.D.) People who agree that athletes should earn PE credit for after-school sports believe that too much physical activity during the school day prevents students from performing their best during after-school practices and games. It was my twelfth birthday. Thanks to my over-active imagination, I had convinced myself that my mom was going to get me a new skateboard. I could not contain my excitement. I really needed a new skateboard, and not because I was bored with my old one. My old skateboard was falling apart. Upon waking up, I ran straight to my mom and asked her to give me my gift. She responded by telling me that I would have to wait until after I got home from school. She went on to say that if she told me what the gift was I would not be able to concentrate on my school work. Those words ensured that I would be so excited about getting my new skateboard that I would be unable to work. After a whole day of counting down the minutes, I arrived home from school. My mom was nowhere to be found. I called her office but did not get an answer. She did not answer her cell phone either. Just as my frustration was peaking, my mom pulled into the driveway. She stepped out of the car, asking, "Why are you looking at me like that?" I excitedly blurted out, "You said I would get my present after school, and it is officially "after school.'" "Oh, is that all? I assumed that you missed your dear mother," she teased. I later regretted my response. "No, that's not all! It's everything!" When I asked her where my gift was, she pointed at the J.C. Penney bag she held. She told me, "It's a new suit for you to wear to church." I muttered in disbelief, "But you said that if you told me about the gift, I would be thinking about it all day long." My mom responded, "I didn't say you would be thinking about it because it's a great gift."Which of the following statements best summarizes the passage? A. A boy wants a new skateboard for his birthday. His old skateboard is breaking down. He has to wait all day to get his birthday present from his mom. B. A boy is sitting in school, wanting the day to be over. He wants to go home to get his birthday present from his mother. He races home only to find his mother gone. C. A boy is expecting to get a skateboard for his birthday. He waits all day to get his birthday present. He is disappointed when he finds out his present is a suit. D. A boy goes to school without his birthday present. He sits in class all day, thinking about his new skateboard. He wants to go home to play with it right away. The space between two bar lines are called There is a bag of marbles that contains 4 blue marbles, 3 red marbles, 2 green marbles, and 1 brown marble. If one was picked at random, not replaced, and another was picked, what is the probability of both marbles selected to be blue? math problem screen picture 1. f (x) = 5x + 10. If x = 10, then what is the value of f(x)?A 25B 6012.D 5 (Worth 10 points) Which of these statements best describes the major conflict in this story?