During a hectic moment in the ER, Robin received a needle stick from a hyperdermic used on the patient. She later was diagnosed with Hepatitis B. This would be an example of what type of transmission?

Answers

Answer 1

Answer:

Fomite Transmission

Explanation:

The type of transmission used as an example in this scenario would be Fomite Transmission. This is when an inanimate object that has been in contact with a disease becomes contaminated and then comes into contact with an individual. In this scenario, once the needle was used on the patient that had Hepatitis B it immediately became contaminated. Then by accidentally being stuck by the needle, Robin became infected as well as the disease was transmitted from the needle into her bloodstream.


Related Questions

what is deposition ?​

Answers

Answer:

it is a geological process where sediments, soil, and rocks are added to a landform or mass

Answer:

Deposition is defined as the removal from an office or the testimony of a witness under oath. An example of deposition is the firing of a person from a government job. An example of deposition is to tell the details of the crime to an attorney before the case goes to court

Explanation:

hope this helps

14. Which nitrogenous base isn't found in DNA?

Answers

Answer:

Uracil is a nitrogenous base found in all RNA but not present in DNA.

Explanation:

plz mark brainliest

Answer:

Uracil

Explanation:

Uracil is a base found in RNA (but not in DNA) and derived from pyrimidine; pairs with adenine. Uracil the nitrogenous based is not found in DNA.

So, the final answer is Uracil.

I NEED HELP, can someone make do this real quick?

Answers

Answer:

The answer is A because abc

2. Which is an example of interspecific competition?

blue jays eating seeds from my bird feeder
white-tailed deer looking for food in a field
polar bears praying on seals in the artic ocean
squash outgrowing lettuce in my garden​

Answers

Inter specific competition occurs when two individuals compete for the same resources. Therefore the correct example would be the squash outgrowing the lettuce.

DNA is normally found in the nucleus as
but condenses into
during cell division.
A. histones, chromosomes
B. chromosomes, chrothatin
C. chromatin, chromosomes

Answers

Answer:

The answer is chromatin and chromosomes.

i think the answer is c

Which wire, when current flows through it, would be surrounded by the strongest magnetic field?

A thin copper colored bar.
A copper colored coil with 2 turns.
A copper colored coil with 5 turns.
A thick copper colored bar.
Mark this and return Save and Exit

Answers

Answer:

A copper with 5 turns

Explanation:

Answer:the other guy is right

Explanation:

can someone please help me with this!

Answers

Answer:

large teeth is dominant on small

Answer:

50%

Explanation:

It's a chart based thing but I don't have one, but it's for sure 50%

Some students correctly made a life cycle model for two specific animals. One group has made a model showing three parts, and another group has made a model showing four parts. Which parts would the group modeling incomplete metamorphosis have in their model?
A. egg, larva, adult
B. egg, nymph, adult
C. egg, larva, pupa, adult
D. egg, pupa, nymph, adult

Answers

C.

The life cycle of a mosquito goes eggs, larva, pupa, adult.

have a wonder day :)

what two gases easily diffuse through the phospholipid bilayer

Answers

Answer:

Consider substances that can easily diffuse through the lipid bilayer of the cell membrane, such as the gases oxygen (O2) and CO2. O2 generally diffuses into cells because it is more concentrated outside of them, and CO2 typically diffuses out of cells because it is more concentrated inside of them.

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC
9. Which amino acids would be found in the mutation protein?
Which amino acids would be found in the mutation protein

Answers

Answer:

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

Explanation:

This question is describing the process of translation, which is the second stage of protein synthesis. Translation is the process whereby a mRNA template is used to produce amino acids, which forms a sequence that will eventually become protein.

The mRNA sequence is read in a group of three nucleotides called CODON. Each codon specifies a particular amino acid. According to this question, using the genetic code table, the given DNA sequence is as follows:

DNA: CAT- TGG- CTA- ACG- TCG- ATA- ATC- GTC- GGT- AC

RNA = GUA- ACC- GAU- UGC- AGC- UAU- UAG- CAG- CCA- UG

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

Ps. Answer is B William meets Kate They both share many of the same beliefs and interests. Based on the effects of similarity on
attraction, which of the following is most likely to be William's reaction?
A William will be more likely to trust Kate than he would a stranger
B. William will be more attracted to Kate than he would a stranger.
C. William will be more likely to love Kate than he would a stranger
D. William will be more likely to distrust Kate than he would a stranger
Please select the best answer from the choices provided
A

Answers

Answer:

William will be more attracted to Kate than he would a stranger.

Explanation:

Option B is your answer choice. Have a great day ☺

On the effects of similarity on attraction, the following is most likely to be William's reaction,  William will be more attracted to Kate than he would a stranger. Thus, option "B" is correct.

How they both share many of the same beliefs and interests?

Research has found people tend to feel attracted to those who are similar to them, which is probably an evolved preference.

Still, there are several explanations for this liking. Psychologist says we believe people who are similar to us will be more likely to like us. Another reason would be that shared experiences and values make us feel more certain and positive in the world. Whatever reason it may be, the truth it psychology sees such tendency as deeply rooted in the human psyche.

Thus, option "B" is correct.

To learn more about psychology click here:

https://brainly.com/question/10980588

#SPJ2

Please help!!!
Which structure is smaller?
A. Chromosome
B. Histone
C. Nucleosome

Answers

Answer:

B. Histone because they are a family of small positively charged proteins.

Process 2 is known as

Answers

Answer:

Transcription

Explanation:

From the available diagram, process 2 converts, or transcribe or copies DNA nucleotide sequence information into RNA sequence information.

Hence, in this case, the correct answer is TRANSCRIPTION

One of the biggest sources of greenhouse gases released into the
atmosphere is emissions from burning fossil fuels. How could carbon
sequestration help alleviate problems associated with burning fossil fuels?
A. It could make fossil fuels a clean-burning energy resource.
B. It could prevent carbon dioxide from being a greenhouse gas.
O C. It could prevent released carbon dioxide from entering the
atmosphere.
D. It could make fossil fuels a renewable energy resource.

Answers

Answer:

The correct answer is - B. It could prevent carbon dioxide from being a greenhouse gas.

Explanation:

Carbon sequestration is the process that involves capturing and removal of atmospheric carbon dioxide from the atmosphere and prevent it from changing climate by increasing global warming as carbon dioxide gas traps the heat.

It is helping in the removal of excess carbon dioxide from the atmosphere and prevents it from being a greenhouse gas and increase global warming. It could be geological or biological.

Answer: C- it could prevent released carbon dioxide from entering the atmosphere

Explanation: ap3x

f(x) = −16x2 + 60x + 16

Answers

Answer:

x = − 0.25 , 4

x = − 1 /4 , 4

Explanation:


When can an acquired mutation be passed from parent to offspring

Answers

If the mutation takes place in a gamete that ends up forming an embryo, the mutation will be passed on to an offspring. This can also occur if the mutation occurs early in an embryos development, and the cell becomes one of the gamete forming cells, the mutation will be passed on to their offspring.

The spinal cord is automatically arranged with

Answers

cervical region

spinal nerves

central canal

Central canal because of science

Choose all the answers that apply.

Which of the following energy sources harms the
environment?

A.) coal
B.) hydroelectric power
C.) nuclear power
D.) oil

Answers

Answer:

c nuclear power because it destroy the places

Oil coal nuclear power

write any two uses of Rocks and Minerals of each?​

Answers

Answer:

The use of rocks and minerals includes  building material, cosmetics, cars, roads, and appliances.

Explanation:

Rocks and minerals are all around us! They help us to develop new technologies and are used in our everyday lives. Our use of rocks and minerals includes as building material, cosmetics, cars, roads, and appliances. In order maintain a healthy lifestyle and strengthen the body, humans need to consume minerals daily

1. Imagine you played the game, and the results are as follows. Examine the tables below and questions (a) and (b)
Sample Data for Stable Food Scenario for EAST SIDE (Wet).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 3 2 2
3 4 4 4
4 5 5 6
Sample Data for Stable Food Scenario for WEST SIDE (Dry).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 2 2 2
3 3 2 2
4 4 2 2
A) Describe what happens to the bird population for both the East and West sides of the Islands in terms of its composition of different size beaks when the food source is stable over several seasons.
B) Are the initial populations maintained, explain?
2. Imagine you played the game again, but under different conditions. Examine the tables below, and answers (a), (b), and (c).
Sample Data for Natural Selection Scenario for EAST SIDE (Wet).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 3 3 3
3 4 3 2
4 8 5 0
Sample Data for Natural Selection Scenario for WEST SIDE (Dry).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 2 2 2
3 2 2 2
4 2 0 3
A) What happened to the composition of the original population over these four seasons for the East and the West?
B) What factor(s) might have caused these changes?
C) How was natural selection acting on this population?

Answers

Answer:

The population is increase in the east due to good and wet environment.

Explanation:

The bird population of the East and west sides of the Islands is increases of different size beaks when the food source is stable over several seasons because the presence of food to all size of beaks leads to increase in their populations. The initial populations is increased in the east side as compared to west side may due to good environmental conditions. The population of east side increases as compared to west side due to good and favourable environmental condition of the east side of the island.

Base your answers to the following question on the structures represented in the diagram.

Review Packet- Modern Genetics Name___________________________ Page 1

What is the relationship between these three structures?

Group of answer choices

Protein is composed of DNA that is stored in the cell

The cell is composed only of DNA and protein

DNA is made up of proteins that are synthesized in the cell

DNA controls the production of protein in the cell

Answers

C. DNA controls the production of protein in the cell

Newborn infants that are exposed to nitrate poisoning are said to be suffering from also known as .

Answers

Nitrate poisoning in newborn infants causes methemoglobinemia, also known as blue baby syndrome

Answer:

Methemoglobinemia.

Explanation:

Body fat in humans includes both essential and storage body fat.

a. True
b. False

Answers

Answer:

true

Explanation:

Answer:

yes that claim is actually true. those are the main fats (correct me if im wrong there)

Create some GREAT SCIENTIFIC game of hide and seek to play in class.

Answers

Answer:

you can place scientific terms around the classroom and the kids must work in groups to find the cards. Then you let the kids read the terms at the end.

Explanation:

Decide if the following statements best describe map-based genome sequencing, best describe whole-genome shotgun sequencing, or apply equally to both sequencing methods.

a. starts with libraries of large, overlapping DNA fragments
b. starts cloning and sequencing of short, random DNA fragments
c. uses genetic recombination data to help arrange sequences correctly
d. requires sequences to be annotated after contig assembly
e. requires chromosome fragments to overlap for contig assembly
f. requires subcloning of large fragments into smaller clones for sequencing
g. is a better approach for repetitive sequences

1. Map-based genome sequencing
2. Whole-genome shotgun sequencing
3. Both sequencing methods

Answers

Answer:

1. Map-based genome sequencing: a; c; f; g

2. Whole-genome shotgun sequencing: b

3. Both sequencing methods: d; e

Explanation:

Map-based genome sequencing is a method that makes use of a reference genome sequence in order to determine the relative position of the DNA fragments before they are sequenced. This method is useful to determine the position of repetitive DNA fragments (for example, duplicated genes, repetitive non-coding regions, etc.) and Transposable Elements. Therefore, map-based genome sequencing is a suitable approach for large genomes (which are usually composed of repetitive sequences). On the other hand, in whole-genome shotgun sequencing, DNA sequences are obtained before the correct order of these DNA fragments is known. In this method, the genome is fragmented randomly into small DNA sequences (between 100 and 1000 base pairs), which are subsequently sequenced through the chain-termination sequencing approach (i.e., Sanger sequencing) and finally ordered by using bioinformatic tools that assemble overlapping reads.

The __
__from farmland is often contaminated with pesticides, herbicides,
fertilizers, and oils used in farm equipment.
A. ammonia buildup
B. runoff
C. livestock
D. acid rain

Answers

Answer:

B. Runoff

Explanation:

Some cells release active signaling proteins when membrane-bound precursor proteins are cleaved by proteolytic enzymes. The signaling proteins can then bind to receptors on the surface of a target cell, thereby activating an intracellular signaling pathway and eliciting a response from the target cell. This mechanism of activating receptor-binding signaling proteins has been observed in a variety of organisms from bacteria to humans. Many of the enzymes responsible for proteolysis of membrane-bound precursor proteins have been isolated and characterized.


Required:

What questions would be most appropriate to investigate whether the proteolytic enzymes are evolutionarily conserved among species?

Answers

Answer:

Following questions would be most appropriate to investigate whether the proteolytic enzymes are evolutionarily conserved among species:

Are the genes encoding the proteolytic enzymes expressed in the same cell types in all species?  Once the precursor proteins of different species are cleaved, do the active signaling proteins bind to  the same receptors on different target cells? If a proteolytic enzyme from one species is incubated with a precursor protein from another species, does correct cleavage occur? Are the proteolytic enzymes synthesized in the rough endoplasmic reticulum of all species?

Which of the following statements about lichens are true?

Answers

Answer:

The photobiont supplies the association organic carbon from photosynthesis, and the mycobiont ensures protection and regulates the supply of minerals and water. The nutritional exchange between partners is probably much more complex than exchange of water and minerals for organic carbon. Thus, the correct answer is option B.

Answer:juegan maincra

Explanation:porque si

1. Geologists use physical properties to identify minerals. For example, the blank

cleavage, color, fracture, hardness, luster, specific, gravity, streak, texture

Answers

Answer:

The correct answer is - crystal form (external shape).

Explanation:

Physical properties are used for the identification of the minerals that include specific gravity, streak, texture, luster color, hardness, cleavage, and crystal form.

The most common physical property of the minerals in crystal form or external shape of the mineral. This is the property of the mineral that gives an idea about the homogenous possessing a 3-D internal order.

Answer:

crystal form external shape

Explanation:

i copied lol

The result of a magma plume rising and decompression melting occurring may
be the formation of a small volcanic region called a(n).

Answers

Hot spot: is the answer
Other Questions
What does an easy money policy do? short term Ill mark brainest What are the qualities of self concept Find area of the shaded region.PLZ I NEED HELP ASAP!!!BRAINLIEST TO CORRECT ANSWER!!!XTRA POINTS!!!NO LINKS!!!I WILL REPORT!!! which of these is true about the big bang model? Which two details about life in ancient Greece did the author use to shape the character cares ? 1. Chares's recklessness and impulsive behavior 2. Chares as a member of a wealthy Thebes family 3. Chares's affection for an Athenian4. Chares's size and physical strength5. Chares contempt for philosophers and poets Michael deposited $2000 into a simple interest savings account. In eight years,he has a total of $2520 in his account. What interest rate did the bank giveMichael when he opened his account?a. 2.5%b. 3.75%C. 3.25%d. 2.25% how deep is the ocean necesito saber el valor que falta en esta fraccion 12/30 = ?/45 The process of deforestation affects the different biogeochemical cycles on earth. Give three examples of how deforestation will affect the various cycles. How did the outcome of World War II change the global balance of power? Which conflict involved troops under Andrew Evans attacking a Comanche camp in southwestern Oklahoma? Read this excerpt from News Articles about Bullying.One of those contacts came in the form of Dash Mihok, an actor who has had roles in major films, including "I Am Legend," and "The Thin Red Line." Mihok, 38, also has Tourette's syndrome. "I grew up with Tourette's in New York City public schools and I was just amazed at the bravery and the fortitude of this young man," Mihok said. "I sent him an email letting him know he had a friend in Los Angeles and his mother asked me to be his mentor. I happily accepted."Together, Jaylen and Mihok have been taking their knowledge into the Polk County school system, holding assemblies to educate students on bullying.What background knowledge would best add to a readers understanding of the excerpt?Tourettes syndrome affects the brain and nervous system, causing people to have uncontrollable movements and speech.Dash Mihok played a number of small roles before starring in movies, making him appreciate his success in films.Polk County Schools represent a large district in Florida, making it necessary for them to engage in anti-bullying efforts.Jaylens mother was very happy that Mihok had befriended her son, so she asked Mihok to become a mentor to Jaylen. factors affect the rate of evaporation accepta) humidityb) nature of liquidc) pressured) temperaturee) turbidity Requirements from the soil for food production in plants i really need help with my socials question!! thank you!Create your own poster that can be used to advertise Canada today around the world. What sells (images) Canada? What slogan will you useto entice people to come to Canada? What appeals to others around the world about coming to live in Canada? Convince people to immigrateto Canada. fourRead the sentences below. Combine them into a compound sentence using one of the coordinateconjunctions. Write a compound sentence using correct punctuation and capitalization.She went to work. She did not want to go." Yo no____ a la escuela todos los dias A.VienesB.VengoC.TienesD.Tengo In which country would women be most likely to have more rights?AustraliaSaudi ArabiaIranChina Please help, I am not able to find the answer Which symbol correctly compares the mixed number and the improperfraction?3 4/6 ? 22/6