due today i have a C and need to bring my grade to a B and will mark brainliest
Read the article about Atlantic killifish
Answer the question in 5-10
Complete sentences
-What types of toxins were found in the waters of the Lower Passaic Superfund site?
-How were some fish able to survive PCB levels thousands of times higher than sensitive fish can withstand?
-What is the advantage of a large population for rapid evolution?
-Do you think all species would be able to evolve adaptations to help them survive pollutants? Why or why not?
-What will likely happen to these toxin-adapted fish if the waters are eventually cleaned up?

Answers

Answer 1

Answer:

-What types of toxins were found in the waters of the Lower Passaic Superfund site?

DDT and agent orange were found in the waters of the Lower Passaic Superfund site.

-How were some fish able to survive PCB levels thousands of times higher than sensitive fish can withstand?

in some tolerant fish, the trigger for the changes that can be caused by PCB levels are can be turned off which allows some fish to survive levels of PCB thousands of times higher than the levels affecting sensitive fish.

-What is the advantage of a large population for rapid evolution?

The advantage of rapid evolution is that the animals can survive and not get killed off.

-Do you think all species would be able to evolve adaptations to help them survive pollutants? Why or why not?

I don't think that all fish can get speedy evolutions like the killfish did because researchers think that they got a rare mutation which helped them survive. However as researchers say, in smaller populations with less diversity the chances that a rare mutation might happen is small.

-What will likely happen to these toxin-adapted fish if the waters are eventually cleaned up?

Once the water becomes clean, a tolerant fish with the mutation won't do as well as a sensitive fish would do.

Explanation:

Can I have brainliest? It would help me out, if not thanks anyways! Hope this helped and have a nice day! Thank you : )


Related Questions

Identify and explain one aspect of your public speaking skills that you can improve. How can you work to improve this aspect?

Answers

Answer:

improve not moving around when you talk

Explanation:

being loud and projecting your voice is a hug part of public speaking

Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

The answer would most likely be whales

Answer:

whales

Explanation:

List one way that mitosis and meiosis are similar
and 1 way they are different.

Answers

The difference they have is mitosis produces two daughter cells with the same number of chromosomes as a parent cells. How they are alike is they are two type of cell divisions and associated with cytokinesis.

Which statement describes the proper procedure for identifying an organism by using a dichotomous key?

Answers

Explanation:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts".

GIVING AWAY 14 POINTS PLEASE HELP ME ON THIS QUESTION ASAP!!!!

Answers

Answer: i think its B or C

Answer: B

Explanation: Hope this help :D

What are the products of photosynthesis?

Answers

Answer:

The reactants for photosynthesis are light energy, water, carbon dioxide and chlorophyll, while the products are glucose (sugar), oxygen and water.

Explanation:

This is where I got the information:

sciencing.com/reactants-products-equation-photosynthesis-8460990.html

I hope this helps!

Which of the following is/are true about energy? (Select all that apply)
energy is only found in fuels
energy cannot be recycled
energy is never destroyed
energy changes form

Answers

Answer:

1 is wrong. 2 is right. 3 is true. 4 is true.

Explanation:

Energy can never be destroyed.

20 POINTS!!!
PLEASE HELP
lmk if you can’t read!

Answers

Answer:

1. Flinch eats the Sun's energy.

2. Fox

3. 6

4. The snake is a secondary predator, while the flinch is a producer.

5. The fox and (bird next to fox name)

Explanation:

NO LINKS! NO PDF'S! NO FILES! JUST ANSWER!!! PLEASE HELP ASAP

Answers

(1. Physical adaptation (2. Behavioral ( 3. physical adaptation (4.behavioral (5. physical (6. behavioral (7. physical (8. behavioral (9. physical (10. behavioral (11. behavioral (12. behavioral

To review, what are the three main types of symbiotic relationships?
A. mutualism. commensalism, and parasitism

B. mutualism, community, practice

C. membership, commensalism, property

Answers

Answer:

A

Explanation:

The three main types of symbiotic relationships are mutualism, commensalism and parasitism

is the A is the one that has the most logic to your question

As fast as you can, name the planets in order from the sun.

Answers

Answer:

Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus, Neptune

Explanation:

Thenks and mark me brainliest :))

Answer: mercury, Venus, earth mars, Jupiter, Saturn, Uranus, Neptune,

and 15 years ago Pluto

Explanation: i should get extra for saying pluto


a. What information could be useful to include in a warning on an e-cigarette ad?

Answers

Maybe the dangers that e-cigarettes can have. A warning that they’re addictive and contain nicotine.

Select the correct answer.
There was an overuse of fertilizers in William's farm. This led to the destruction of the crops, and William incurred huge losses. Which
management function was neglected in this process?
OA. organizing
OB. staffing
OC. planning
OD directing
O E. controlling

Answers

Answer:

OB. staffing

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

Examine the photograph. Identify at least three natural resources being used. Describe where each natural resource came from.

Answers

Answer:

Water- from water comes from a variety of sources, including many of the same sources as tap water.

Leather- from rawhide and skins. The most common raw material is cattle hide.

plastic- from cellulose, coal, natural gas, salt and crude oil through a polymerisation or polycondensation process

Explanation:

<3

Which of the following is evidence that cells no longer respond to external factors and may have turned cancerous?

A. New cells replace old or damaged cells.
B. Cell clumps form, crowding existing cells.
C. Dead cells are shed at a more rapid rate.
D. Dormant cells re-enter an active cell cycle.

Answers

Answer:

option C will be the correct answer

Dead cells are shed at a more rapid rate is evidence that cells no longer respond to external factors and may have turned cancerous.

What are the cancer cells?

Cancer cells are defined as cells which divide continually, forming solid tumors or flooding the blood with abnormal cells. Cell division is a normal process used by the body for growth and repair.

Sometimes this orderly process breaks down, and abnormal or damaged cells grow and multiply when they shouldn’t. These cells may form tumors, which are lumps of tissue.

For more information regarding cancer cells, visit:

https://brainly.com/question/373177

#SPJ2

a scientific ________ is based on the results of numerous experiments.

Answers

Answer:theor

Explanation:

b

what is the botanical name of milk​

Answers

Answer:

Milk of magnesium's scientific name is magnesium hydroxide, and the scientific name for milk of sulfur is precipitated sulfur.

The botanical name of milk is not applicable, as it is not a plant or a plant product. Botanical name is the scientific name given to plants, fungus and algae.

Milk is a nutrient-rich fluid produced by mammals. It is frequently consumed as a source of nutrients and is renowned for having a lot of calcium. Water, lipids, proteins, carbs, vitamins, and minerals are all present in milk in complicated proportions.

There is no particular botanical name for milk in the field of biology, which is the study of plants and their categorization. Different plant species are identified and categorized using botanical names.

Milk lacks a botanical name since it is a byproduct of animals, not plants.

Learn more about botanical names here:

https://brainly.com/question/20532715

#SPJ6

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

Over time, data that support the successful evolution of a species would include observations that describe

Answers

More body cells and more genetic changes happening

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?

Answers

Answer:

True

Explanation:

As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.

Hence, the given statement is true

Humans depend on the biodiversity of living things for all of the
following EXCEPT

A. Weather
B. Food
C.medicine
D.shelter

Answers

The answer to your question is c!
answer should be A
hope this helps :)

Find a recent article that is centered around life science and give a report about it.....answer these 3 questions: 1) How is this article related to life science? 2) What interesting information did you read about in this article? 3) Why would this article be important for others to read?

Answers

I think the answer is A but I’m not sure have a great day buddy let me know if I can help with anything else

A man is HH for a trait, while his wife is hh. What will their children

Answers

Explanation:

I hope what I have drawn on the picture will help you understand:)

¿Cual es la importancia biológica de los estímulos umbrales?

Answers

Answer:

En electrofisiología, el potencial umbral es el nivel crítico al que debe despolarizarse un potencial de membrana para iniciar un potencial de acción.

Explanation:

En neurociencia, los potenciales de umbral son necesarios para regular y propagar la señalización tanto en el sistema nervioso central (SNC) como en el sistema nervioso periférico (SNP).

Espero que esto ayude :))

Help please! I haven't read The Immortal Life of Hennrietta Lacks and need help with this! Due today!

Answers

I honestly don’t know what book this is but I will read it it’ll prolly take 3 hours but I’ll come back
Other Questions
A 110 kg football player running with a velocity of 5.0 m/s hits another stationary footballplayer who has a mass of 90 kg. Upon impact, the first player immediately stops, thus propellingthe second player backwards. What is the final velocity of the second player? Please help ASAP with questions what powers are shared between state and federal government If a woman who is colorblind marries a man with normal vision, what is the probability of their son being colorblind? *0%50%100% Finn wants to learn about a jazz vocalist who had a long, successful career. Who should Finn study to learn more about an influential jazz singer?A. Duke EllingtonB. Miles DavisC. Ella FitzgeraldD. Buddy Bolden Please help! Urgent! On a time crunch! 1) King Burger sells 3900 hamburgers per hour worldwide. At this rate, how many hamburgers would they sell in one minute?2) In Mrs. Hewitt's Class, 7 out of 35 students play soccer. What percentage of the class does NOT play soccer?3) The ratio of blue balloons to red balloons in a bouquet is 12:9. If a birthday bouquet has 36 blue balloons, how many red balloons should there be? Help in French: How do you conjugate French words for imparfait and future tense that doesn't have -ir, er, and re? For instance interessant or any other words without the ir,re,er words. A ......................... occurs in the moon period. What is 5.704 expressed to two decimal places? 19. I need help fastCorey overheard his Mom expressing her concern that lifting a few bags of groceries was not as easy as it used to be and she had to stop and start white carrying themCorey's Mom has decided to begin an exercise program, Using your knowledge of health-related fitness components, Corey should suggest to his Mom she needs to improveher: (2 points)Body Mass IndexCoordinationFlexibilityO Muscular endurance AYUDA estoy atrapada!!!!!!!!!!!Resuelve las siguientes ecuacionesa) 2 000 + x = 3x 1 000b) 5m -7 = 13 3mc) 6n +6 = 4n +12d) 7x + 12 = 5x + 20e) 5x + 3 = 2x + 9 please help me!!!!lol evaluate sals relationship with her dad walk too moons What is a good amount of calorie deficit per day if you are looking to lose two pounds? Usually eat around 2000 calories per day To increase the energy of an electromagnetic wave, which property shouldyou increase?A. ShiftB. FrequencyoC. WavelengthD. Speed Help me please i will mark brainliest PLEASEEEEE HELPPPPP NOWWEEEE Which point on the number line best represents V22 A person with type AB blood could receive transfusions from donors with _____.type A bloodtype AB bloodtype B bloodtype O blood Is quadrilateral UVWX a parallelogram? Why or why not?A) There isn't enough information.B) Yes, because adjacent sides aren't perpendicular.C) No, because opposite sides aren't congruent.D) Yes, because opposite sides are parallel.