Answer:
Nucleotide fragments of the sequence 1:
1. CCTAGCCGCCGGAGCCGGATCTTGCCGGATCGGC (base 19 to base 52)
2. CCTAGAACGG (base 9 to base 18)
3. CCTCGG (base 3 to base 8)
4. GG (base 1 to base 2)
Nucleotide fragments of the sequence 2:
1. CCTAAGCGATTCCCGGATATAGACTCCGGATTCGCTAAGGG (base 7 to base 47)
2. CCTATAT (base 48 to base 54)
3. CTGAGG (base 1 to base 6)
Explanation:
HaeIII is a restriction enzyme isolated from Haemophilus aegyptius bacteria, which is widely used in molecular biology laboratories. This enzyme is an endonuclease, i.e., it cleaves phosphodiester bonds within a polynucleotide chain. HaeIII is a restriction enzyme that cleaves DNA at the recognition sequence 5′-GG/CC-3'.
Which process is the most efficient in yielding atp molecules?
5) What is the control center of a cell?
Answer:
the nucleus
:)
Answer:
Nucleus
Explanation:
The nucleus contains the DNA of a cell. It regulates important cellular activity such as cell division and protein synthesis
Hope this helps! Have a great day :)
what is the difference between a mollusk and an annelid?
Answer:
Segmented worms vs invertebrates
Explanation:
Mollusks are invertebrates such as snails, scallops, and squids. Different classes of mollusks have different ways of obtaining food. Annelids are segmented worms such as earthworms and leeches. Annelids have a coelom, closed circulatory system, excretory system, and complete digestive system.
What type of leaf is this?
Answer:
COLEUS I THINK
Explanation:
HELP PLS First, Demetri will test the three solutions containing milk (lactose).
He begins the experiment by preparing the lactase enzyme solutions. In one beaker he dissolves 1 lactase tablet in 100 mL of water at room temperature. He stirs the mixture until the tablet has dissolved completely. He repeats this process in a second beaker, and then heats the beaker until the solution is boiling.
Demetri then tests these three milk (lactose) solutions for the presence of glucose:
milk in water
milk and lactase enzyme in water
milk and heated lactase enzyme in water
Test Tube 1 - Milk (Lactose): Demetri fills the first test tube one-quarter full of milk. Then, he slowly adds water to the milk until the test tube is three-quarters full. Using the stirrer, Demetri thoroughly mixes the solution. Then he inserts the test strip for 30 seconds and records its color.
Test Tube 2 - Milk (Lactose) and Lactase Enzyme: Demetri fills the second test tube one-quarter full with milk. He then adds the lactase-and-water solution until the test tube is three-quarters full. He uses a stirrer to thoroughly mix the solution. Next, Demetri inserts the test strip for 30 seconds and records its color.
Test Tube 3 - Milk (Lactose) and Heated Lactase Enzyme: Demetri fills the third test tube one-quarter full with milk. He then adds the heated lactase-and-water solution until the test tube is three-quarters full. After stirring, Demetri inserts the test strip for 30 seconds and records its color.
According to the test strips, which of these milk solutions contained glucose?
Answer:
2nd test tube, because test strip color turned to green, which indicates this test tube solution contained glucose.
Explanation:
Lactase will break down the lactose into glucose and galactose. In first test tube there is no such activity because there is no lactase presented. In 3rd test tube as the enzyme is heated so it is get decomposed so in this case also there is no activity of lactase enzyme.
The second tube is the tube that contained glucose.
We can arrive at this answer because:
Lactase is a protein.This protein has the function of breaking lactose into smaller molecules, which are glucose and galactose molecules.This protein is sensitive to high temperatures and loses functionality in very hot environments.In the case of the tests used in the question above, we can say that in the first test tube, the lactase solution was not added, so the lactose was not broken down. The lactase solution was added to the second test tube, where the lactose was broken down generating glucose and galactose. In the third test tube, the heated water prevented the lactase from acting and therefore it cannot break down the lactose.
Therefore, only the second tube has glucose.
More information:
https://brainly.com/question/13129?referrer=searchResults
Which of the following scenarios can be classified as a positive feedback loop?
1.increase in blood pressure to reduce the heart rate
2.increase in red blood cell production due to low oxygen levels
3.sweating to cool down skin cells
4.increased platelet production to help blood clotting
Answer:
D
Explanation:
In order to prevent blood loss, the body needs a mechanism that amplifies the action that leads to clotting in a short period of time. This cascade or enhancement of a process is a positive feedback mechanism.
What percent of your body weight is comprised of water?
O A.
approximately 20%
B.
approximately 40%
C.
approximately 60%
OD.
approximately 80%
Answer:
About 80 so I guess D.
Explanation:
Answer:
approximately 60% in adults
Explanation:
.........
How is sodium different than the other types of matter
Answer: Todo depende de a que materias te refieres pero una de las mayores diferencias es que el sodio es un enlace iónico
Explanation:
A city is considering switching to geothermal power for their electricity needs. Which of the following is an advantage of this plan?
1. It is commonly used across the entire United States.
2.It uses less land area than gas power plants.
3.It uses water to power large turbines.
4.It in inexpensive to build.
It uses water to power large turbines.
Geothermal power taps on the energy of natural steam from the earth's lithosphere.
Explanation:
The heat from deep in the the lithosphere heats up underground water into high-pressure steam trapped in within the rocks. Boreholes are sunk to tap on the potential energy of this high-pressure steam to turn large dynamo turbines that convert the steam energy into electricity.
The biggest advantage, moreover, is the fact that this method of electricity generation does not emit greenhouse emissions as compared to gas plants that burn hydrocarbons that release CO₂.
Two students are eating lunch. One student tells the other who is eating a peanut butter and jelly sandwich, "All the energy stored in that sandwich came from plants harnessing the power of the sun as chemical energy!" Is this statement true or false?
Answer:
its true
Explanation:
thats what photosynthesis is-
Answer:
Very much True.
Explanation:
Most everything we eat comes from the trees and plants that let us breath. Wheat Bread or bread in general? Wonder how they make that. Wheat of course! Wheat also happens to be a plant, and even though it doesn't look like your normal plant. It still has the same process of photosynthesis. Thus, harnessing energy from the sun for food.
Which part of the cell membrane is non polar and prevents the cell from dissolving.
Answer:
Non polar fatty acids
Explanation:
In the chemical equation for photosynthesis, carbon dioxide and water are converted to glucose and oxygen.
6CO2 + 6H2O ® C6H12O6 + 6O2
Which component could be added to complete this chemical equation?
light energy
ATP and NADPH
chemical energy
rubisco
Answer:
A.) Light energy
Explanation
just trust
Where does the energy that powers the nitrogen cycle come from?
Answer:
When nitrogen is absorbed by the soil, different bacteria help it to change states so it can be absorbed by plants. Animals then get their nitrogen from the plants. Fixation - Fixation is the first step in the process of making nitrogen usable by plants. They absorb nitrates from the soil into their roots.
Explanation:
Answer:
When nitrogen is absorbed by the soil, different bacteria help it to change states so it can be absorbed by plants. Animals then get their nitrogen from the plants. Fixation - Fixation is the first step in the process of making nitrogen usable by plants. ... They absorb nitrates from the soil into their roots.
Explanation:
my teacher gave me the wrong test but i still wanna know the answer to this question
a lichen is an example of
What is the role of the carbon cycle? (100 points) Detailed answers please!
Answer:When new life is formed, carbon forms key molecules like protein and DNA. It's also found in our atmosphere in the form of carbon dioxide or CO2. The carbon cycle is nature's way of reusing carbon atoms, which travel from the atmosphere into organisms in the Earth and then back into the atmosphere over and over again.
Explanation:
Answer:
the carbon cycle is the process in which co2 i
travels from the atmosphere to organisms and back to the atmosphere. The four steps of the carbon cycle are photosynthesis, decomposition, respiration, and combustion. Then carbon cycle starts by carbon moving from the atmosphere to plants. The carbon then moves from plants to animals. And then it moves from plants and animals to soil. The carbon then moves from living things back to the atmosphere. Carbon also moves to the atmosphere from the burning of fossil fuels. carbon also moves from the atmosphere to the oceans. Carbon is a life sustaining element . The carbon cycle is important because it move carbon throughout different ecosystems.
Stella is preparing a sterile tray for a dressing change. While preparing the tray, a nurse calls her name, and she turns her back on the tray for a few minutes. What should Stella do next?
Answer:
Stella would have to create a new sterile tray.
Explanation:
Since Stella was distracted by her name she heard she would of to create another sterile tray because while preparing a tray, the sterile tray must be in sight throughout the whole procedure of preparation, never turn your back on the sterile tray because the sterility cannot no longer be guaranteed if the back is turn on it because anything might have happen or particles or airborne microbes might have flown into it which can render it . non sterile. Sterile tray should be set close or at the time of use.
Which organisms are eukaryotes?
animals
plants
archaea
fungi
Answer:
Bacteria and archaea are prokaryotes, while all other living organisms — protists, plants, animals and fungi — are eukaryotes.
Explanation:
Among the mentioned types of organisms, animals, plants and fungi are eukaryotes and archaea are prokaryotes.
What are eukaryotes?The organisms having a true membrane-bound nucleus with membrane-bound organelles in their cell are called eukaryotes. Eu - true, karyon - nucleus. So the word eukaryotes mean the organism having a true nucleus.
In the 5 kingdom system of classification, every kingdom except Monera consists of eukaryotes. Monera consists of unicellular prokaryotes and this includes two groups of organisms, they are archaea and bacteria.
Protista, fungi, Plantae and Animalia kingdoms consist of eukaryotes. Protists are unicellular eukaryotes and the rest are multicellular eukaryotes.
Kingdom fungi include saprophytic multicellular eukaryotes. The kingdom Plantae includes photosynthetic multicellular eukaryotes. The kingdom Animalia includes heterotrophic multicellular eukaryotes.
Therefore, the correct options are animals, plants and fungi.
Read more about, eukaryotes here
https://brainly.com/question/11351358
#SPJ6
Fasttttttttttttttttttttttttttttttt 15 points
Which claim has the highest degree of objectivity?
O A scientist working for a real estate company wrote an article stating that the air quality in that town was the best
in the state.
O A research team working at a university wrote an article stating that multiple experiments have shown that marine
ecosystems are sensitive to water pollution
O A research team working for a bread company wrote an article stating that their company's bread is healthier
than the competitor's bread.
O A doctor who appears in commercials for a specific medicine wrote an article stating that many people could
benefit from taking that medicine.
Answer:
A research team working at a university wrote an article stating that multiple experiments have shown that marine ecosystems are sensitive to water pollution.
Explanation:
Answer:
B. A research team working at a university wrote an article stating that multiple experiments have shown that marine ecosystems are sensitive to water pollution.
Explanation: Got this right on edge ;)
13 Pepsin is a protein which is produced in the stomach and is one of the main digestive enzymes found in
many animals. This enzyme breaks down proteins found in food into smaller peptides. Chymotrypsin and
trypsin are also enzymes and play a similar role as pepsin in the digestive system. What is the primary
role of all digestive enzymes?
A) Increase the amount of energy needed to digest food
B) Ensure that waste products are quickly removed
C) Speed up chemical reactions involved in nutrient breakdown
D) Fight off any pathogens found in the body
Answer:d
Explanation:
GIZMOS student exploration:iconic bonds....Does anyone have the answer sheet?
What is the percentage of Thymine if you have 18 % Guanine in a strand of DNA?
32
25
22
18
Answer: 32%
Explanation: Remember the base pairing rules: cytosine with guanine and adenine with thymine, in equal amounts. That being said, the amount of cytosine is equal to the amount of guanine, meaning that it is 18% as well. Since 18+18=36, you know that the remaining 64% is adenine and thymine collectively. To figure out how much of each base there is, you could divide 64% between each nitrogenous base to get 32% each.
Hope this helps,
Lacia :)
Which cell organelle is responsible for a plant’s shape/structure and can be found in a piece of lumber (tree bark) that was cut from a tree last year?
chloroplast
cell wall
cell membrane
nucleus
Answer:
nucleus
Explanation:
In chemical reactions, bonds fll in the blank in reactants
Answer:
In a chemical reaction, reactants contact each other, bonds between atoms in the reactants are broken, and atoms rearrange and form new bonds to make the products
Explanation:
plsssssssssssssss help
What happens to the length of the observer's shadow when there is sunsrise and sunset
Answer:
This was from my test review sheet and here is what it says: "The parent diameter of the sun sure is predictable changes in size."
So, i think it is unpredictable by the changes of the shadow because you didn't show a picture for any of the time of the day.
Hope this helps!
Have a great day/night and stay safe! :) :D
I really need the answer to both of these and I’ll give brainliest to the first answer
Answer:
The first one is Carbohydrate and second one is protein
Explanation:
Answer:
the first is carbohydrates and the second one is protein
Write a short paragraph describing the roll of all four types of lipids: fats, phospholipids, waxes, and steroids.
Answer:
Phospholipids have four major components: fatty acids, a glycerol component, and both a phosphate group and a polar molecule. Human sex hormones, like testosterone and estrogen, are classed as steroids. Steroids most often have a four-fused ring structure. Waxes are composed of alcohol and a fatty acid.
Explanation:
Magic
Name two nutrients that are recycled through an ecosystem
Answer:
Carbon, nitrogen, hydrogen, oxygen, phosphorus, and sulfur. Water is also recycled.
Explanation:
Living factors or organism that affect an ecosystem
Answer:
Biotic components are living organisms in an ecosystem. A biotic factor is a living organism that affects another organism in its ecosystem. Examples include plants and animals that the organism consumes as food, and animals that consume the organism.
Explanation:
