De niña, era muy sociable. Yo hablar) mucho
Conjugate the verb into the imperfect.

Answers

Answer 1

Answer:

De niña, yo era muy sociable. Yo hablaba mucho

Answer 2

Answer:

De niña, era muy sociable. Yo hablaba mucho con mis amigos y familiares. Me gustaba contar historias y chistes. Siempre tenía algo que decir. No me daba vergüenza expresar mis opiniones y sentimientos. Era una niña muy comunicativa y extrovertida.

MARK AS BRAINLIEST!!!


Related Questions

¿Dónde has _________________ las maletas? (poner)
Responses ponido puso puesto

Answers

Answer: puesto

Explanation: it made the more sense out of all the answers choices

Answer:

⇒  puesto.                                                                                

Explanation:

¿Dónde has puesto las maletas?

...

que tipo de cursos se necesita para ser forense de criminalista?

Answers

Para convertirse en un forense o criminalista, generalmente se requiere una combinación de educación formal, capacitación específica y experiencia práctica. A continuación se presentan los pasos típicos y los tipos de cursos que son necesarios para ingresar a este campo:

1. Grado universitario: Lo primero que se necesita es obtener una licenciatura en un campo relacionado con las ciencias forenses o la criminalística. Algunas opciones comunes incluyen:

- Ciencias forenses: Algunas universidades ofrecen programas de licenciatura específicamente en ciencias forenses, que cubren temas como la recopilación y análisis de evidencia, la fotografía forense, la balística, etc. - Biología o química forense: Estos programas se centran en las aplicaciones forenses de la biología y la química, como el análisis de muestras de ADN, toxicología forense, análisis de sustancias químicas, etc. - Criminalística: Algunas instituciones ofrecen programas de licenciatura en criminalística, que abarcan una amplia gama de disciplinas forenses, incluyendo la escena del crimen, la recolección de evidencia, el análisis de patrones de sangre, etc.

2. Estudios de posgrado (opcional): Si deseas avanzar en tu carrera y acceder a roles más especializados o de liderazgo, es posible que desees considerar obtener un título de posgrado en ciencias forenses, criminalística o un campo relacionado. Los programas de maestría y doctorado pueden proporcionar una formación más profunda y te permitirán especializarte en un área específica de interés.

3. Cursos especializados en ciencias forenses: Durante tu educación universitaria o como parte de la formación continua, deberás tomar cursos especializados en ciencias forenses. Estos cursos pueden incluir:

- Fotografía forense: Aprenderás técnicas de fotografía para documentar la escena del crimen y la evidencia. - Análisis de huellas dactilares: Te enseñarán a recopilar y analizar huellas dactilares. - Análisis de ADN: Aprenderás las técnicas utilizadas para analizar muestras de ADN y cómo interpretar los resultados. - Balística forense: Estudiarás los principios de la balística y cómo se utilizan para analizar y comparar evidencia de armas de fuego. - Análisis de manchas de sangre: Aprenderás sobre la interpretación de patrones y rastros de sangre en la escena del crimen. - Toxicología forense: Estudiarás cómo se analizan las sustancias químicas en muestras biológicas para determinar la presencia de drogas, venenos u otras sustancias.

4. Práctica y capacitación en el campo: Además de la educación formal, es importante obtener experiencia práctica en el campo forense. Esto generalmente se logra a través de pasantías, prácticas o trabajos de laboratorio en agencias forenses o instituciones académicas. También puedes beneficiarte de programas de capacitación específicos ofrecidos por organizaciones y agencias especializadas en ciencias forenses.

Recuerda que los requisitos y

las opciones educativas pueden variar según el país y la institución. Es recomendable investigar los programas académicos y las certificaciones profesionales disponibles en tu área para obtener información más precisa y actualizada.

[tex][/tex]

Escoge.


No ____________ que tú hace veinte años que trabajas aquí.
Question 2 options:

me di cuenta de

invertí

me apoderé

logré

Answers

Answer:

+. me dí cuenta de.

Explanation:

+. No me di cuenta de que tú hace veinte años que trabajas aquí

...

based on the text, what do the cousins play with first at home

Answers

seeing as there is no text attached, here are some verbs/adjectives that can help you :)
firstly - primero
cousin - primo
to play - jugar
home - hogar
hope this helps!

tipos de organizaciones de forense de criminalística.

Answers

Existen varios tipos de organizaciones criminales forenses, tales como:

Laboratorios ForensesOrganizaciones no gubernamentalesAgencias Gubernamentales de Investigación

¿Qué son las organizaciones forenses?

Corresponden a instituciones cuyo ámbito central es analizar e investigar situaciones que involucran la naturaleza de un delito, en busca de su solución, tales como laboratorios forenses que investigan muestras de ADN, balística, documentos, etc.

Por lo tanto, estos organismos forenses de diversa índole son fundamentales para que un país pueda resolver de manera confiable y consistente distintos tipos de delitos, contribuyendo a una mayor justicia y seguridad en el país.

Encuentra más sobre organizaciones de forense de criminalística en:

https://brainly.com/question/9522242

#SPJ1

Complete with object pronouns. ¿Quién les sirvió la comida a los pasajeros a bordo del avión? ​ El asistente de vuelo _______ _______ sirvió. Responses les les la se la nos lo

Answers

El asistente de vuelo SE LA sirvió.

que tipo de programas se necestian para ser forense de criminalística?

Answers

Los tipos de programas que se necesitan para ser forense en criminalística son materias relacionadas a la medicina y la biologia, ya que esto ayuda a obtener un conocimiento mas acabado de la escena del crimen.

¿Que se requiere para estudiar criminalística?

Las cuestiones relacionadas a la criminalística  son aquellas que estudian como resolver casos criminales, lo cual es un area de suma importancia en investigacion judicial.

En conclusion,  la criminalística forense  se basa en las caracteristicas de los sistemas biologicos y como tales es necesario tener un conocimiento de biologia y medicina en esta carrera.

Aprende mas sobre biologia en:

https://brainly.com/question/23862922

#SPJ1

Other Questions
A patient asks you to record them getting stitches with their phone, are you allowed to do this since its their request and device? Verify that x (y + z) (x y) + (x z) when x = 12, y = -14 and z = 2. The merchandise trade balance: a. is the difference between a country's exports and imports of goods b.is the difference between sales of assets to foreigners and purchases of assets by foreigners. c. includes the value of services traded. d. is not part of the current account. Over the coming year, a small manufacturing business has projected its sales and costs to be as follows: Units sold = 5,000 Total sales revenue = 500,000 Total fixed costs = 100,000 Total variable costs = 120,000 a) Determine the following: i) Total profit over the period ii) Marginal profit per unit iii) Number of unit sales required to break-even. b) A risk analysis carried out for the company indicates that two scenarios may occur during the year which could affect company sales. Firstly, a new competitor has entered the sector leading to a possible decrease in sales by 5%. Secondly, raw material costs could increase by 15 %. Perform the cost analysis for these two scenarios to determine the effect on total profit. Calculate the percentage change in the profit for both scenarios and consider what actions the management could take to minimise the risk. Transcribe the following dna strands into mrna strands: ATTCGACGTCGATAGCTAGG The poetry of Li-Young Lee often focuses on logic, conflict, andacademic references.True or false You currently have $16,000 in your savings account. At whatnominal interest rate compounded semi-annually would your savingsgrow to $32,211.62 in 21 years? Use the Indirect or Short Method: Identify if the argument isvalid or invalidP --> (Q & R) / R --> S // P -->S What city has the largest population of Jewish Americans in the United States ? Labor relations in the public (government) sector differs in several ways from that in the private sector. In no more than a paragraph each, discuss the relevance of the following five (5) factors as regards the public sector.a) the applicable statuteb) the role of public opinion and the mediac) multilateral and end-run bargainingd) due process rights of employees under Board of Regents v. Rothe) Impact of Janus v. AFSCME cf. Abood v Detroit Board of Education A couple borrows $1.6 million to buy a house. The loan term is 25 years, with equal monthly payments at a fixed interest rate of 4.2% PA. After how many years will they have paid off half the principal. Clearly show any formulae and workings. The management of Kunkel Company is considering the purchase of a $23,000 machine that would reduce operating costs by $5,000 per year. At the end of the machine's five-year useful life, it will have zero salvage value. The company's required rate of return is 12%. Click here to view Exhibit 14B-1 and Exhibit 14B-2, to determine the appropriate discount factor(s) using table. Required: 1. Determine the net present value of the investment in the machine. 2. What is the difference between the total, undiscounted cash inflows and cash outflows over the entire life of the machine? Complete this question by entering your answers in the tabs below. Required 1 Required 2 Determine the net present value of the investment in the machine. (Negative amounts should be indicated by a minus sign. Round your final answer to the nearest whole dollar amount. Use the appropriate table to determine the discount factor(s).) Net present value A manager makes decisions very quickly and requires little information for making the decisions. Which of the following is a likely reason for this?A) The manager has low self-esteem.B) The manager has an external locus of control.C) The manager is high in emotional stability.D) The manager is high in risk-taking. Suppose that there are many stocks in the security market and that the characteristics of stocks A and B are given as follows: Stock A E(r) 14%, Std Dev 6%. Stock B, E(r) 18% ;Std Dev 10% . Suppose that it is possible to borrow at the risk-free rate, r. What must be the value of the risk-free rate? (Hint: Think about constructing a risk-free portfolio from stocks A and B.) Do not round intermediate calculations. Round your answer to 3 decimal places - truncate trailing zeros. Do not enter percent signs (no %) I need help with this its geometry this is my 2nd time asking for help Tamika is a newly hired VP leading Macys digital marketing department. She quickly learns that Macys is late to integrate social media into their overall integrated marketing strategy. Tamika wanted to form a new team in her department that will focus on social media marketing.Tamika drafted a budget to fund the new team, and she is scheduled to deliver a presentation to senior management for their approval of the new budget. She knows that Macys revenue is down 25%, and senior management is resisting any new expenditures.Tamika knows she needs help with the presentation, so she asks her top manager, Manny, to put together some information that identifies the major types of content marketing.Knowing that a brand needs permission to use an image that they found on the internet, what are the major types of content that Manny should use in the report.Using the ranking of the different types of content (based on popularity), how could Manny help Tamika persuade senior management to approve the new budget? Using environmental analysis tools (PESTEL MODEL.), assess thestrategy of launching Gigafactories in China and Germany in postcoronavirus era. (effective, not effective, why? possibleoutcome...) Solve the absolute value inequality. |7x+12| -6 Select the correct choice below and, if necessary, fill in the answer box to complete your choice. A. The solution set is (Type your answer in interval notation. Use integers or fractions for any numbers in the expression. B. The solution is the empty set. Cultures that are strong in uncertainty avoidance:condition individuals to accept uncertainty.tend to be easygoing.tend to be flexible to different views.do not impose clear rules as to how one should behave.condition people to seek security through technology and law. First impressions and why they often become Lasting impresions?