Can you please put the steps in the correct order?

Can You Please Put The Steps In The Correct Order?
Can You Please Put The Steps In The Correct Order?

Answers

Answer 1

Answer:

DNA unzips and unwinds

A gene in DNA is transcrived into an mRNA

The mRNA is transported

the last 2 describe the same process

Explanation:


Related Questions

NO LINKS! NO PDF'S! NO FILES! JUST ANSWER!!! PLEASE HELP ASAP

Answers

(1. Physical adaptation (2. Behavioral ( 3. physical adaptation (4.behavioral (5. physical (6. behavioral (7. physical (8. behavioral (9. physical (10. behavioral (11. behavioral (12. behavioral

¿Cual es la importancia biológica de los estímulos umbrales?

Answers

Answer:

En electrofisiología, el potencial umbral es el nivel crítico al que debe despolarizarse un potencial de membrana para iniciar un potencial de acción.

Explanation:

En neurociencia, los potenciales de umbral son necesarios para regular y propagar la señalización tanto en el sistema nervioso central (SNC) como en el sistema nervioso periférico (SNP).

Espero que esto ayude :))

20 POINTS!!!
PLEASE HELP
lmk if you can’t read!

Answers

Answer:

1. Flinch eats the Sun's energy.

2. Fox

3. 6

4. The snake is a secondary predator, while the flinch is a producer.

5. The fox and (bird next to fox name)

Explanation:

what're the two body systems opossums use to fake their death?

Answers

Apparent death, colloquially known as playing dead, feigning death, or playing possum, is a behavior in which animals take on the appearance of being dead. This form of animal deception is an adaptive behavior also known as tonic immobility or thanatosis. Apparent death can be used as a defense mechanism or as a form of aggressive mimicry, and occurs in a wide range of animals.

When induced by humans, the state is sometimes colloquially known as animal hypnosis. According to Gilman et al.,[1] the investigation of "animal hypnosis" dates back to the year 1646 in a report by Athanasius Kircher.

Opossums do not virtually play lifeless whilst they are threatened. Instead, they involuntarily input a catatonic kingdom.

Opossums, as they're generally called, are much more likely to run the alternative way, uncover their tooth, and growl in risky situations.

Playing dead is an involuntary reaction at the a part of the opossum. The strain of the war of words going through the opossum reasons him to enter surprise. This surprise induces a comatose kingdom that may remain for forty minutes.

Why ringtail Opossums don't play dead.

No, ringtail Opossums they do not, they make a sound, you could concentrate on it on the subsequent post: Strange Australian Back Garden Beastie Sounds.

Therefore it is clear that they play dead by unover their tooth and growling in risky situations.

To learn more about opossums refer to the link;

https://brainly.com/question/1056658

The biological selection of a particular allele for a trait to be passed to offspring has nothing do with the selection of the allele for another trait. Which of the following supports this statement?​

Answers

Answer:

1

Explanation:

Examine the photograph. Identify at least three natural resources being used. Describe where each natural resource came from.

Answers

Answer:

Water- from water comes from a variety of sources, including many of the same sources as tap water.

Leather- from rawhide and skins. The most common raw material is cattle hide.

plastic- from cellulose, coal, natural gas, salt and crude oil through a polymerisation or polycondensation process

Explanation:

<3

Identify and explain one aspect of your public speaking skills that you can improve. How can you work to improve this aspect?

Answers

Answer:

improve not moving around when you talk

Explanation:

being loud and projecting your voice is a hug part of public speaking

Which of the following statements is true. *
10 points
Sperm : Produced in ovaries Eggs: Produced in testes
Sperm: Produced in testes Eggs: Produced in ovaries

Answers

Answer:

sperm produced in testes, Eggs produced in ovaries

Humans depend on the biodiversity of living things for all of the
following EXCEPT

A. Weather
B. Food
C.medicine
D.shelter

Answers

The answer to your question is c!
answer should be A
hope this helps :)

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

Over time, data that support the successful evolution of a species would include observations that describe

Answers

More body cells and more genetic changes happening

To review, what are the three main types of symbiotic relationships?
A. mutualism. commensalism, and parasitism

B. mutualism, community, practice

C. membership, commensalism, property

Answers

Answer:

A

Explanation:

The three main types of symbiotic relationships are mutualism, commensalism and parasitism

is the A is the one that has the most logic to your question

Cuando se excita una neurona con estímulos de intensidad creciente se obtiene, a partir del umbral, la misma respuesta eléctrica. En esta situación se pone de manifiesto la característica de: *
A) ley del todo o nada.
B) período refractario relativo.
C) período refractario absoluto.
D) excitabilidad.
E) umbral de excitación.

Answers

Answer:

d) excitabilidad

Explanation:

creo que seria esa no lo sé

no se mucho de eso

me dices si sale buena o mala

Apply what you know about lipids to explain why the cuticle helps prevent water loss in plants. Compare it to what humans do.

Answers

Answer:

Explanation:

Waxy cuticle is a white powdery substance that is insoluble, it is found usually on the surface of stem or leave and it prevent excessive loss of water through transpiration.

It is an adaptive mechanism used in dry areas or desert to help plants retain water that is needed for their growth by reducing amount of water loss through transpiration.

Cactus is an example of plant with cuticle that thrive well in dry areas

An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?

Answers

Answer:

True

Explanation:

As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.

Hence, the given statement is true

what is the botanical name of milk​

Answers

Answer:

Milk of magnesium's scientific name is magnesium hydroxide, and the scientific name for milk of sulfur is precipitated sulfur.

The botanical name of milk is not applicable, as it is not a plant or a plant product. Botanical name is the scientific name given to plants, fungus and algae.

Milk is a nutrient-rich fluid produced by mammals. It is frequently consumed as a source of nutrients and is renowned for having a lot of calcium. Water, lipids, proteins, carbs, vitamins, and minerals are all present in milk in complicated proportions.

There is no particular botanical name for milk in the field of biology, which is the study of plants and their categorization. Different plant species are identified and categorized using botanical names.

Milk lacks a botanical name since it is a byproduct of animals, not plants.

Learn more about botanical names here:

https://brainly.com/question/20532715

#SPJ6

Find a recent article that is centered around life science and give a report about it.....answer these 3 questions: 1) How is this article related to life science? 2) What interesting information did you read about in this article? 3) Why would this article be important for others to read?

Answers

I think the answer is A but I’m not sure have a great day buddy let me know if I can help with anything else

1. The process of translation is responsible for producing which type of molecule?

A. Polypeptide
B. RNA strand
C. DNA strand
D. New gene


Answers

rna strand im pretty sure

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries

a scientific ________ is based on the results of numerous experiments.

Answers

Answer:theor

Explanation:

b

PLEASE HELP! WILL GIVE BRAINLIEST. Describe the contribution of photosynthesis and cellular respiration to the exchange of carbon between the atmosphere and the biosphere.

Answers

Cellular respiration and photosynthesis are essential to the carbon cycle because cellular respiration involves the intake of oxygen o2 and the exhale of carbon-dioxide co2 into the atmosphere. Where photosynthesis uses the carbon dioxide and water to create oxygen and sugars through energy to repeat the cycle. Respiration in general is a process where carbohydrates are turned into dihydrogen monoxide or water and co2(carbon dioxide). Living organisms together throughout the biosphere and atmosphere work together to continue this because carbon itself is an organic substance.

Answer:

Explanation:   Cellular respiration and photosynthesis are important parts of the carbon cycle. The carbon cycle is the pathways through which carbon is recycled in the biosphere. While cellular respiration releases carbon dioxide into the environment, photosynthesis pulls carbon dioxide out of the atmosphere.

As fast as you can, name the planets in order from the sun.

Answers

Answer:

Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus, Neptune

Explanation:

Thenks and mark me brainliest :))

Answer: mercury, Venus, earth mars, Jupiter, Saturn, Uranus, Neptune,

and 15 years ago Pluto

Explanation: i should get extra for saying pluto


Which of the following is a way in which the atmosphere does NOT
interact with the hydrosphere? *
A). Decreasing the salinity of oceans from increased temperatures causing glacial
melting.
B). Developing hurricanes over warm ocean currents.
C).Increasing the amount of water evaporation from oceans and global temperatures
rise.
D). Gases moving sediment from hill tops

Answers

The correct answer is d. Please give me brainlest let me know if it’s correct or not okay thanks bye

based on questions 6 , 7 or 8 what happens to the voltage required in a circuit as the resistance decreases ? increases ?

Answers

Answer:

As the resistance decreases the Voltage Increases

Explanation:

PLEASE HELP JUST MATCH THEM UP

BRAINIEST ANSWER!!!

Answers

Explanation:

71% of the Earth----All of water on Earth

97%of water on Earth----- Salt water

77%of the freshwater on Earth------Frozen in Glaciers

22% of fresh water on Earth----- water Underground

What are the products of photosynthesis?

Answers

Answer:

The reactants for photosynthesis are light energy, water, carbon dioxide and chlorophyll, while the products are glucose (sugar), oxygen and water.

Explanation:

This is where I got the information:

sciencing.com/reactants-products-equation-photosynthesis-8460990.html

I hope this helps!

Other Questions
Find the volume of the prism. L=25, W=16, H=24 Please answer the question in the picture MAKE SURE THAT THE ANSWER U CHOOSE IS THE CORRECT ANSWER Which of the following is NOT a characteristic of a civilization?GovernmentTechnologyWeatherCulture The diameter of Circle X is 18 cm. The diameter of Circle Y is 29 cm. Which circle has the greater area and by how much? Use 3.14 for . Use pencil and paper. Describe two ways you can compare the areas of two circles. Explain when you might prefer to use each. Help me plzzzzzzzzzzzzzzzZzzzzzzZ I said to her why do you tell a lie change into indirect speech The modern behavioral task, introduced by Dr. Larry D. Reid, named ______ is used to measure the rewarding aspects of drugs. The brain structures underlying the rewarding properties of drugs of abuse include the cortical-amygdala and orbital frontal cortical pathways and can be reliably demonstrated when animals are tested drug free using a combination of operant and classical conditioning learning tasks A scientist is investigating the effects of electromagnetic radiation on plant growth. She wants to test the plants with two different types of electromagnetic waves: one with a very long wavelength and one with a very short wavelength. Ideally, the waves will have the greatest possible difference in wavelength. Which two types of waves should she choose?A.visible light waves and radio wavesB.infrared rays and ultraviolet wavesC.radio waves and gamma raysD.microwaves and X rays Every day, Jackie practices basketball and guitar. Each day,she practices basketball for 1.5 hours. If after 6 days shepracticed both basketball and guitar for a total of 21hours, how many hours per day did Jackie practice guitar? 11. please help me outt ill mark you brainlist ! Find the sum of the first 8 terms of the following series, to the nearest integer. 28,14,7,... b) What are the only two sources of energy that produce all the energy we use on Earth? What formof energy does each of these sources use? can someone please help me with this??? im trying to correct test answersn = ? D(5, 7), E(4, 3), and F(8, 2) form the vertices of a triangle. What is mDEF?A) 30B) 45C) 60D) 90 What are some signs that someone is having difficulty managing their stress? A bottle of Hydrogen Peroxide is labeled 9.5% by volume. How many milliliters of H2O2 are in 480.00ml bottle of this solution which number sentence is true? plz help 3 boxes on top 8 boxes on the bottom 2/3 < 6/8 2/3 < 2/8 1/8 > 1/3 3/3 < 3/8 stWhich statement accurately describes the United States' foreign policy in the post-Cold War period?60%The United States reopened diplomatic and economic ties with Communist nations.and economicThe United States used the threat of a nuclear attack to make its enemies follow Its policies.enturyThe United States sought to promote democracy and peace in nations around the world.smThe United States was willing to use force to stop the spread of communism.8096Which statement accurately describes the United stated foreign policy in the post cold war period? find the cost of running a 60watt for 24hrs. if the electrical energy cost 5 kobo per unit A daimyo was the same as Medieval European knight. *TrueFalse