can someone plzz help me on this question its hard :( and i want to pass

Can Someone Plzz Help Me On This Question Its Hard :( And I Want To Pass

Answers

Answer 1

Answer: A

Explanation:

Your welcome


Related Questions

How does type 1 diabetes affect the cardiovascular system?

Answers

Answer:

diabetes can damage your blood vessels and the nerves that control your heart and blood vessels, causing to have a bad affect on your cardiovascular system.

List 4 chordate characteristics.

Answers

Answer:

notochord, dorsal hollow nerve cord, pharyngeal slits, and a post-an4l tail

Explanation:

had to censor second to last word but the 4 is an a

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

1. In the diagram, the arrow #9 is pointing to an organelle called





mitochondria
nucleus
smooth endoplasmic recticulum
endoplasmic recticulum

Answers

Answer:

Mitochondria

Explanation:

need help asap, will mark brainliest. PLSSS
How would an increase in the amount of solar energy available most likely affect a terrestrial community?

The amount of atmospheric carbon would decrease.
The amount of nitrogen in biomass would decrease.
The amount of sedimentary phosphorus would increase.
The amount of water in reservoirs would increase. (ik its not this one)

Answers

The correct answer is C.

The amount of sedimentary phosphorus would increase.

Have a great day! Mark if correct!

Native vegetation determines the _________________________ and _________________________ of organic matter in the soil.

Answers

Answer:

Explanation:

Texture

What are some things you think would help identify a fossil? *

Answers

Answer: by studying the Fossil record we can tell how long life has existed on earth,and how different plants and animals are related to each other.often we can work out how and where they lived, and use this information to find out about ancient environments fossils can tell us about a lot about the past.

Explanation: If you like it please mark brainlest....

Those individuals that are better able to survive in the Environment tend to be:

Answers

Answer:

Fit

Explanation:

They are the ones who are strong enough to survive.

I NEEEEEDDDD HELP PLEASE

Answers

Answer:

Proteins.

Explanation:

Genes contain instructions to  assemble amino acids in proteins.

In rabbits, spotted coat (S) is dominant to solid color (s) and black (B) is dominant to brown (b). A true-breeding black spotted rabbit is mated to a true-breeding brown solid rabbit to produce a heterozygous F1 generation. Two F1 individuals are mated, and you do not see a 9:3:3:1 (black spotted: black solid: brown spotted: brown solid) ratio of offspring, but instead see that almost all offspring are a non-recombinant phenotype. This tells you that

Answers

Answer:

Epistasis effect result into these offspring

Explanation:

Given

spotted coat (S) is dominant to solid color (s) and black (B) is dominant to brown (b)

Genotype of true-breeding black spotted rabbit BBSS

Genotype of  true-breeding brown solid rabbit bbss

Genotype of offspring BbSs

In normal crossing between BbSs and BbSs offspring of F1, should produce offspring in the ratio 9:3:3:1

But it does not happens in this case the simple reason could be  presence of Epistasis in which the alleles assort independently but do not express themselves because of the following reasons -

a) Interaction between two or more loci thereby resulting into new phenotypes

b) An allele at one locus masks effects of other allele at one or more loci

c) Allele at one locus modifies the effects of alleles at one or more other loci

What are some physical properties of the sun?

Answers

Answer:

Mass: 1.98892 x 1030 kg.

Diameter: 1,391,000 kilometers.

Radius: 695,500 km.

Surface gravity of the Sun: 27.94 g.

Volume of the Sun: 1.412 x 1018 km3

Density of the Sun: 1.622 x 105 kg/m3

Explanation:

PLEASE HELP


The theory of plate tectonics is supported by evidence that crustal plates move relative to each other. How does this observation support the theory of plate tectonics?
It suggests that plates are dragged around by ocean currents.
It suggests that plates are dragged around by air currents.
It suggests that plates can move independently of one another.
It suggests that plates cannot move independently of one another.

Answers

Answer:

Its c the third answer

Explanation:


Which term best describes the joints at the top of your
skull?

A.) Motionless
B.) Flexible
C.) Rubbery
D.) Elastic

Answers

Answer: A

Explanation:

the joints on the top of your skull is motionless

Tell me if you think caecilians are amphibians, reptiles, or fish.

Answers

Answer:

Amphibians

Explanation:

Our atmosphere is composed of several gases. The name of the gas we breathe, O2, is A) oxygen squared B) monoxide. C) oxide. D) diatomic oxygen.

Answers

A. Oxygen Is the most abundant

GIVING BRAINLIEST AND THE REST OF MY POINTS!!!! :)



What life cycle adaptation does the desert gold poppy have that helps it reproduce and survive in its dry desert environment?

A) It produces large amounts of spores.
B) It only produces seeds in the summer when it is driest.
C) Its seeds stay dormant until there is enough precipitation for them to grow.
D) It can produce seeds all year round that can grow in dry and wet conditions.

Answers

The answer is c. It hides its seeds until it is wet enough for them to reproduce.

What is true about one strand of DNA?


It contains many chromosomes.


It contains many proteins.


It contains many pieces of RNA.


It contains many genes.

Answers

Answer:

it contains many genes.

Answer:

D: It contains many genes

which problem do you think contributes most to water scarcity?

Answers

Answer:

Agriculture consumes more water than any other source and wastes much of that through inefficiencies. Climate change is altering patterns of weather and water around the world, causing shortages and droughts in some areas and floods in others. At the current consumption rate, this situation will only get worse.

-WWF

Plant cells are different from animal cells. The diagram below identifies four different structures in a plant cell. Compared to the structures in an animal cell, which of the following structures is found only in a plant cell?

a. Mitochondrion
b. Cell Wall
c. Cytoplasm
d. Nucleus

Answers

B.cell wall , hope this helps
The cell wall is only found in a plant cell

what was explained by darwins theory of biological evolution

Answers

Answer:

When Organism A has a trait that negatively impacts it, or lacks a trait which would positively impact it, then said organism perishes, and its genes are not passed onto the next generation. On the flip side, when Organism B has a trait that positively impacts it, or lacks a trait that would negatively impact it, then the organism thrives, and its genes are passed onto the next generation.

Therefore, the next generation receives genes from Organism B and does not receive genes from Organism A. So, the next generation has traits that positively impact it and lacks traits that would negatively impact it, thus evolving according to Darwin.

Explanation:

What was explained by it? Evolution. But how did it explain evolution? That is in the answer.

in dogs, being clumsy (C) is dominant to being cool (c) and being dazzling (D) is dominant to being docile (d)

Answers

Answer:

i didnt know that..!

Explanation:

Answer:

9/16

Explanation:

CcxCc = CC, Cc, Cc, cc (3/4)

DdxDd = DD, Dd, Dd, dd (3/4)

3/4 x 3/4 = 9/16

Why don't individuals with Tay-Sachs pass on the Tay-Sachs
allele?
a
Tay-Sachs disease is a recessive human genetic
disorder.
b Carriers are not affected.
c Affected individuals do not have children.

Answers

Answer:

Affected individuals do not have children.

Explanation:

what is the term for the process of cell division that results in the formation of gametes ?​

Answers

Answer:

meiosis

Explanation:

can you please answer these questions for me I really need help I am begging you

Answers

Answer:

1: 75%

2: 75%

3: 50%

4: 25%

Sunlight allows producers and the animals that depend on them to live in the ______ zone.
A.abyssal
B.neuritic
C.bathyal
D.intertidal

Answers

The answer is bathyal

Answer: B. Neuritic zone

Which of the following correctly describes how DNA contributes to the traits that appear in offspring? A) DNA contains the instructions for building RNA, which influences traits. B) DNA contains the instructions for building proteins, which create the physical traits of offspring. C) DNA contains the instructions for building carbohydrates, which are responsible for the physical traits of offspring. D) DNA contains the instructions for building enzymes, which catalyze chemical reactions for the traits of offspring.

Answers

a dna contains the instructions

DNA attributes to the genotype preference to the individual.  DNA contains the instructions for building RNA, which influences traits. The correct statement is answer A.

What is the full form of DNA ?

DNA stands for deoxyribonucleic acid.

DNA contains the orders that are needed for any organism in order  to develop, survive as well as reproduce. To carry out these duties, DNA sequences are needed to be converted into messages which can be used to produce proteins in  which are the complex molecules that are  doing  most of work in our body.

Since we have two pairs of chromosomes and we also have two pairs of genes in which  one  is from our father and one is  from mother. These pairs of genes then determine certain physical features or traits.

Learn more about DNA at :

https://brainly.com/question/264225

#SPJ2

What fossil is evidence that animals moved from living in the water to dry land? If u could help thanks!

Answers

Answer:

Tiktaalik roseae

Explanation:

The discovery of the fossil, Tiktaalik roseae on a Canadian island gives credence to the fact that animals moved from living in water to living on dry land. This fish which has feature of land animals such as a neck, skull, and ribs is believed to have lived some 375 million years ago. It also has features of fish such as the fins and scales.

The discovery of this fossil is important to scientists because it confirmed their believe that there should be an organism that would prove that life transitioned from water to land. The fossil was discovered in the year 2004.

Sound waves move the slowest through which medium? water ice air wood

Answers

Answer: The answer is the following.

the question is: sound waves move through which medium?

a. water

b. ice

c. air

d. wood

the best answer to this question would be c. air. <3

Explanation:

The Speed of Sound: Sound travels at different speeds depending on what it is traveling through. Of the three mediums (gas, liquid, and solid) sound waves travel the slowest through gases, faster through liquids, and fastest through solids. Air is a gas so therefore, C. AIR IS THE CORRECT ANSWER :)

The sound waves move the slowest through which medium:

C.Air

The sound waves move the slowest through which medium is air. Sound travels at different speeds depending on what it is traveling through. Of the three mediums (gas, liquid, and solid) sound waves travel the slowest through gases, faster through liquids, and fastest through solids.

Therefore, the correct option is C.

Know more :

https://brainly.com/question/14405871?referrer=searchResults

Someone PLEASE HELP!!!

Answers

Answer:

Autosomal Recessive

Explanation:

The method of inheritance is autosomal recessive. Notice how the disease skips the parent generation. This indicates that parents have the recessive allele but do not express the trait. The individuals who are shaded in have two recessive alleles that were passed on from their parents, therefore they have the disorder.

Examine the Punnett square below. A cross between the two parents results in 50 offspring. How many of the offspring are most likely to have the dominant trait?

Answers

From what I know a punnet square like that gives a 75 percent chance of the dominant trait to that offspring. I’m not entirely good at the subject but I hope that helps?
75 % ........................
Other Questions
Use the weather map below that shows areas of High and Low Pressure to help you answer the question.Which location is likely experiencing the most WIND Who painted the image above? The top two most profitable Fortune 500 companies in 2016 were Apple and JP Morgan Chase & Co. JP Morgan Chase & Co.'s revenue was $29 billion less than Apple's revenue. The total revenue for both companies was $77.8 billion. Which of the following scenarios will decrease the genetic variation of a population? Drawing materials are usually dry, though we include ink as a drawing medium.Discuss the dramatic differences between where drawing began as a mediumand what its applications are today in contemporary film, photo-realism andnarrative storytelling (comics). A triangle has two sides of length 14 cm and 21 cm. Which of the following could represent the length of the third side of the triangle? Select all that apply. 5 cm 15 cm 25 cm O 35 cm 45 cm A water storage tank is cone shaped. The radius of the tank is 20 feet and the height of the tank is 35 feet.Study the figure below... 20 feet... 35 feet... Which measurement represents the volume of the water storage tank Find the quotient of 1/34 7/8 written in the simplest form. What is the percentage change from 2.50 to 2.00? Please help i have a 28 in math What the outcome was on the stonewall riots if you need to read the passed this is on newsela 4/5y - 8 = 2/5y + 16 Consider the following relation with functional dependencies as shown below.R{sno,sname,age,cno,cname,group}R(A,B,C,D,E,F)A-B,CC-FD-Ewhich normal form is the relation R is in? (-5,0) with a rotation of 90 counterclockwise Can someone summarize the Siege of Vicksburg for me? Please don't respond with a link, there's dudes on here that reply with links and it doesn't help aaa dump truck can carry 8 tons. How many pounds can the dump truck carry Landon used a semicircle, a rectangle, and a right triangle to form the figure shown.6 cm4 cm10 cmWhich is the best estimate of the area of the figure in square centimeters? Italian Work If someone knows help please Explain the flow of energy in the food chain and why stored energy is an important concept of it. 6. The substance whose Lewis structure shows triple covalent bonds isa. Hydrogen dioxideb. Nitrogen trihydridec. Carbon monoxided. Carbon tetrachloride