Who warned the Freedom Riders not to go into Alabama?

Answers

Answer 1

Answer:

Martin Luther King

Explanation:

Hope this helps!


Related Questions

Why would people give up some rights in a social contract?​

Answers

theory that by contract people surrender to the sate the power needed to maintain order and the state, in turn, agrees to protect its citizens

which of the following best describes the general situation in postwar americal

Answers

Answer:

After the Second World War, the United States took more strength as the engine of the Western world.The United States in the postwar period became a world military and economic power

Answer:

low unemployment

The New Deal affected Us domestic policy by A expanding the size and scope of the federal government. B. Increasing the number of Americans who had health insurance. C. limiting the size and scope of the federal government. D. decreasing the number of entitlements available to Americans. SUBMIT​

Answers

D.

Explanation:

And hope it helps u

Answer: A

Explanation: just took the test


Describe the two major political parties in the United States and explain their
ideas about how the country should be governed.

Answers

Answer:

The Republican Party believes in a small government and low taxes. They are mostly nationalist. they are right wing. The Democratic Party believes in larger  government and high taxes on the rich. They are liberals/ left wing.

Explanation:

haha i was about to answer this but the person above me did first me lol anyways the person above me is correct

In what ways does South Korea’s government restrict the freedom of its citizens?

Answers

They have around 20 or so types of hair cuts they get get & limited access to internet sites. that’s all i know from the top of my head !

PLEASE HELP ME!!!!! I WILL GIVE BRAINLIEST

Drag each tile to the correct box. Match the economic terms with their definitions.

Giving up one or all alternatives to obtain another

The value of the second-best alternative, which is given up when making a choice among alternatives

The additional cost of making a change or a choice

A condition in which the quantity of a resource is limited in comparison to the number of people who want that resource

Comparing the additional costs and additional benefits of a choice


Choices:

scarcity

trade-off

opportunity

cost

marginal analysis

marginal cost​

Answers

Answer: hello! :) have a good day! :)))

Scarcity ---> A condition in which the quantity of a resource is limited in comparison to the number of people who want that resource.

Trade-off ---> Giving up one or all alternatives to obtain another.

Opportunity cost ---> The value of the second-best alternative, which is given up when making a choice among alternatives.

Marginal analysis ---> Comparing the additional costs and additional benefits of a choice.

Marginal cost ---> The additional cost of making a change or a choice.

C
Jacques and Gina want to start their own company. Combined, they possess art, engineering, technical, and
business skills necessary to form and run a company.
What is the first economic question they need to answer before starting their company?
O How much should be produced?
O How should it be produced?
O Who should it be produced for?
O What should be produced?
Intro
Done

Answers

Answer:

O What should be produced?

Answer:

Explanation: hope this help

Name:
Date:
Parts of the Declaration
Fil out the chart below with the different parts of Declaration of Independence.
Section
Name/Purpose
Details
Part
1
Part
2
Part
3
Part

Answers

1) vacuole= ur school canteen (if u hve one)  

2) chloroplast = ur science teachers  

3) lysosomes= ur MATH TEACHER!!!!!!!!! lol  

4)NUCLEUS=UR PRINCIPAL'S OFFICE  

5)Golgi body = ur school bus  

6) cell wall= guards at ur school

What is the purpose of the poster? And who is its intended audience? Why was this message required?

Answers

Answer:

The purpose of posters are to educate and create awerness on what is happening on a topic.

Intended audience are the passer-by and those who stumble upon it online and children and those who practice them e.g a poster about what happens to those who smoke.

Like I said to educate and teach on the dangers of doing them.and also for awerness

Explanation:

What is an interest group and are they an effective way for American citizens to participate in the political process?

Answers

Answer:

Interest groups serve as a means of political participation for their members. interest groups is to influence decision-makers and public policy through advocacy on behalf of members. They can participate by voting, volunteering, participating in group activities, and community gardening.

Explanation: Hope this helps.

True or false? Over time the Roman influence in the Byzantine Empire faded and the Greek influence became more prominent.

Answers

Answer:

True

Explanation:

please help!
Which of the following was not a cause of the Great Depression?
-Overproduction
-High unemployment rates
-Bank runs/ failures
-Under Consumption
-Full employment
-Stock Market Crash

Answers

Answer:

B

Explanation:

Slight guess

Have an amazing night ❤️

I'm a little stuck, please help. :)

Answers

Answer:Ive got no idea, what does the pages say?

Explanation:

help help help help no link math

Answers

Answer: but =

Explanation: their all the same

Match the items.The task is to match the lettered items with the correct numbered items. Appearing below is a list of lettered items. Following that is a list of numbered items. Each numbered item is followed by a drop-down. Select the letter in the drop down that best matches the numbered item with the lettered alternatives. a. Escape conditioning b. Avoidance conditioning 1. A mosquito is biting your arm and you slap it. You are more likely to slap mosquitos biting your arm in future b 2. A mosquito is flying around you and so you slap it so that it does not bite you. You are more likely to slap at mosquitos flying around you in future

Answers

Answer:

1. A

2. B

Explanation:

Operant conditioning can be defined as an associative learning process which involves reinforcing the strength of a behavior. Thus, the outcome depends on the response in operant conditioning.

A reinforcement of a desired behavior involves the process of strengthening a positive behavior being exhibited by an individual through the use of stimulus. Therefore, making the behavior to be exhibited in the future by the individual.

1. Escape conditioning: A mosquito is biting your arm and you slap it. You are more likely to slap mosquitos biting your arm in future. An escape conditioning can be defined as a type of conditioning in which a subject such as a human learn how to avoid a stimulus that is aversive i.e the aversive stimulus is eliminated by the occurrence of the stimulus.

2. Avoidance conditioning: A mosquito is flying around you and so you slap it so that it does not bite you. You are more likely to slap at mosquitos flying around you in future. An avoidance conditioning can be defined as a type of conditioning in which the occurrence of the behavior prevents the aversive stimulus.

Which key factors led to Chicago becoming an important city for trade? Select two options. PLEASE HURRYYYY

central location
banking services
space to expand
transportation network
technology companies

Answers

Answer:

the correct answers are central location and space to expand

Answer:

A and C

Explanation:

cuzz im a brainy dude

Explain five ways through which the rights of an individual can be violated​

Answers

Here is a link I chose I and not a bit ttyls/https:/history.gov

Samajik samuh ki teen visheshtaen likhiye​

Answers

Answer:

सामाजिक समूह की सबसे प्रथम विशेषता यह हैं कि इसमे मनुष्यों का संग्रह होना आवश्यक हैं। सामाजिक समूह के निर्माण के लिए कम से कम दो मनुष्यों का संग्रह होना आवश्यक हैं। केवल एक व्यक्ति की उपस्थिति को समूह नही कहा जा सकता। इसे पारस्परिक सम्बन्ध भी कहा जाता हैं।

Confucius taught that parents and children should cooperate and have equal power in their relationship.

a. True
b. False​

Answers

Answer:

false

Explanation:

becouse parents are older than children

A crime is any action that is against the law and causes harm to others.
true or false

Answers

Answer:

true

Explanation:

true

crime is any action that is against the law and causes harm to others.

Which of the following best defines the underlined word in the following sentence?


“Any accused person has the right to an Which of the following best defines the underlined word in the following sentence?

“Any accused person has the right to an (impartial) jury.”
A.
compassionate
B.
harsh
C.
fair
D.
knowledgeable jury.”

A.

compassionate

B.

harsh

C.

fair

D.

knowledgeable

Answers

C. Fair

Proof: impartial basically means no prejudgment

What was the significance of the ratification of the 15th Amendment to the U.S. Constitution?
Select one:

It granted citizenship to African Americans.

It outlawed discrimination in public places.

It provided for the admission of new states to the Union.

It granted the right to vote to African American men.

Answers

Answer:

It granted the right to vote to African American men.

Explanation:

It is the amendment that allowed people to vote regardless of skin color.

How did the invention of the railroad contribute to a boom in cattle ranching?
A
It became less expensive for workers to travel to work on cattle ranches because they could take trains.

B
The price of land in the West plummeted, so ranchers were able to buy huge tracts of land for grazing cattle.

C
It became cheaper to transport cows nationwide, so meat was more affordable and demand increased.

D
Land used to graze horses began to be used for cattle as horses became less important for transportation.

Answers

Answer:

C

Explanation:

it became more easy to transport the cattle and meet so in that case it was less expensive

How does the 1st amendment protect us?

Answers

Answer:

The First Amendment guarantees freedoms concerning religion, expression, assembly, and the right to petition. It forbids Congress from both promoting one religion over others and also restricting an individual's religious practices.

The five freedoms it protects: speech, religion, press, assembly, and the right to petition the government. The First Amendment protects us against government limits on our freedom of expression, but it doesn't prevent a private employer from setting its own rules. ...

Plz need the answer asap plz dont give links many people have gave me links that i dont need i need the answer :)

Answers

Answer:

The answer is A

Hope this helps

Read the following excerpt from the Truman Doctrine and answer the question below.

"The seeds of totalitarian regimes are nurtured by misery and want. They spread and grow in the evil soil of poverty and strife. They reach their full growth when the hope of a people for a better life has died.
We must keep that hope alive.
The free people of the world look to us for support in maintaining their freedoms."

Describe the tone of President Truman's address to Congress.

Answers

Explanation:  I used this for mine so you need to chnage the words and i didnt really get the question so i dont know if this is right but i tryed my best here :)

Answer:

He is describing totalitarianism as regimes that are based on misery and want and the people that believe/follow those are in poverty and strife so they want the successful people dead.  The tone is kinda saying fight with me I can help but also has a negative connotative towards totalitarianism.

please answer this question correctly I beg you please only answer if you know the correct answer and please no no links please please please please I beg you I beg you answer this question if you know the answer correctly

Answers

Answer:

1. A

2. C

3. either b or d

Explanation:

Artists such as Banksy would most likely argue that the conditions in Africa alluded to in the Image are in large part the result of which of the following?​​​​​​​
African governments directing economic development in the aftermath of decolonization
African countries lacking the natural resources to support sustained economic growth
International economic organizations imposing free-market reforms on African states
Regional trade organizations advancing the interests of large African states at the expense of smaller African states

Answers

Answer:

The First Option

Explanation:

Artists like Banksy argues that the conditions now in Africa is due to the International economic organizations imposing free-market reforms on African states.

Free Markets

In the world of economics, a free market is that in which the prices or the cost of the comodities and servces are determined by the sellers and the consumers by negotiating.

The prices in this system are determined by the unrestricted competition between the privately owned businesses.

Many international organizations have imposed free market economies in various parts of Africa which had greatly affected its economy.

Learn more about "free markets" here :

https://brainly.com/question/2180746

Which region of the US was based on mining?

Answers

Answer:

Mining in the United States has been active since the beginning of colonial times, but became a major industry in the 19th century with a number of new mineral discoveries causing a series of mining rushes. In 2015, the value of coal, metals, and industrial minerals mined in the United States was US $109.6 billion. 158,000 workers were directly employed by the mining industry.[1]

The mining industry has a number of impacts on communities, individuals and the environment. Mine safety incidents have been important parts of American occupational safety and health history. Mining has a number of environmental impacts. In the United States, issues like mountaintop removal, and acid mine drainage have widespread impacts on all parts of the environment. As of January 2020. the EPA lists 142 mines in the Superfund program.[2]

how did lonnie johnson's accomplishments impact the general public

Answers

Answer:

At the end of the summer of 1944, the Jewish High Holidays arrive: Rosh Hashanah, the celebration of the new year, and Yom Kippur, the Day of Atonement. Despite their imprisonment and affliction, the Jews of Buna come together to celebrate Rosh Hashanah, praying together and praising God's name.

Other Questions
CO Use the following coordinate plane to write the ordered pair for each point Maria has 3 more than Jose. If Jose has x dollars, how much money do they havetogether? What are the five main phases of the cell cycle? What are the main events in each? I need help with this question on IXL Locations with extreme climates and few resources tend to have lower populations. True or False? Can someone pleaseeee help and if youre correct ill give brainliest Can someone please help me!?WILL MARK BRAINLIEST :) I NEED HELP ASAP!!!!!!! will give brainliest How does the content of the passage reflect the author's point of view?A. It shows that the author feels hopeless about the fate of our planet.B. It provides facts and statistics showing that the problem of water shortages is growing.C. It shows that the author dislikes the fact that cities are growing faster in the southwest than elsewhere.D. It shows that the author approves of ongoing scientific research. How was Benjamin Franklin similar to Enlightenment thinkers? The path of a rope bridge can be modeled by a quadratic equation h(l), where h is the height at a point on the bridge relative to the two ends of the bridge and l is the distance from one end of the bridge. One such bridge connects two ends that are 24 meters apart. The lowest point of the bridge is 3 meters lower than the two ends of the bridge Assuming the two ends of the bridge are at an equal height of h = 0 meters, which of the following graphs could be the graph of h (l)? why do some scientists believe that humans evolved from apes?a: because fossil records show homologous structures indicating a common ancestor b: because humans and apes lived around the same time period After sitting out of a refrigerator for a while, a turkey at room temperature (69F) isplaced into an oven. The oven temperature is 300F. Newton's Law of Heatingexplains that the temperature of the turkey will increase proportionally to thedifference between the temperature of the turkey and the temperature of the oven, asgiven by the formula below:T = Ta + (T. T.)e-ktTg = the temperature surrounding the objectTo = the initial temperature of the objectt= the time in hoursT = the temperature of the object after t hoursk = decay constantThe turkey reaches the temperature of 127F after 3 hours. Using this information,find the value of k, to the nearest thousandth. Use the resulting equation todetermine the Fahrenheit temperature of the turkey, to the nearest degree, after 5hours.Enter only the final temperature into the input box. Based on what you read about the Compromise of 1850, what would you say was the worst part about it for the future of the United States and why? in 3/4 of an hour Ryan codes 3/5 of his game. at this rate how much of the game can he code in 1 hour The ratio that compares the measurements of a model and the real object is called what? help ASAP For brainlessly what is the complementary DNA of TACCGGATGCCAGATCAAATC? Which transition would best fit in the blank?We need to wash the dishes. ( ), we can go to the county fair.O A. AlthoughO B. After thatC. MeanwhileD. Similarly Relationship break up because of a number of reasons.Name and explain Two factors that contribute to a detrimental relationship? Solve for x given the picture I need an explanationWill mark brainliest