In which biome is biodiversity most threatened?
OA) wetland
B) taiga
OC) grassland
D) tropical rain forest

HELP ASAP

Answers

Answer 1
The answer is Grassland im 99% positive
Answer 2
D . tropical rain forest
because tropical biomes contain some of the most globally biodiverse areas and their unsustainable exploitation results in massive losses in biodiversity and their ability to preform globally important ecological services

Related Questions

write any two uses of Rocks and Minerals of each?​

Answers

Answer:

The use of rocks and minerals includes  building material, cosmetics, cars, roads, and appliances.

Explanation:

Rocks and minerals are all around us! They help us to develop new technologies and are used in our everyday lives. Our use of rocks and minerals includes as building material, cosmetics, cars, roads, and appliances. In order maintain a healthy lifestyle and strengthen the body, humans need to consume minerals daily

You suggest using a logistic growth model instead. Your colleague agrees, and recommends harvesting the bass population down to just under carrying capacity. Their argument is that the population will remain large and population growth will be fastest if it is harvested down to this size. A) Why is this argument incorrect

Answers

Answer and Explanation:

The error of this argument is to state that a population will remain large and increase when it is close to the carrying capacity. This is because the carrying capacity is the term that determines that a population of living beings is living in an environment that has the minimum resources for their survival, because that population has already consumed the resources. In this case, when a bass population comes close to carrying capacity, the amount of environmental resources is starting to become scarce or limited, this will cause a decrease in the size of the population, because many members of the population will not have access to the necessary resources and will die, decreasing the population. In addition, reproduction among members of the population will be reduced, which will prevent the population from remaining large, since the mortality rate will be higher than the birth rate.

f(x) = −16x2 + 60x + 16

Answers

Answer:

x = − 0.25 , 4

x = − 1 /4 , 4

Explanation:

Some students correctly made a life cycle model for two specific animals. One group has made a model showing three parts, and another group has made a model showing four parts. Which parts would the group modeling incomplete metamorphosis have in their model?
A. egg, larva, adult
B. egg, nymph, adult
C. egg, larva, pupa, adult
D. egg, pupa, nymph, adult

Answers

C.

The life cycle of a mosquito goes eggs, larva, pupa, adult.

have a wonder day :)

The __
__from farmland is often contaminated with pesticides, herbicides,
fertilizers, and oils used in farm equipment.
A. ammonia buildup
B. runoff
C. livestock
D. acid rain

Answers

Answer:

B. Runoff

Explanation:

can someone please help me with this!

Answers

Answer:

large teeth is dominant on small

Answer:

50%

Explanation:

It's a chart based thing but I don't have one, but it's for sure 50%

I NEED HELP, can someone make do this real quick?

Answers

Answer:

The answer is A because abc

14. Which nitrogenous base isn't found in DNA?

Answers

Answer:

Uracil is a nitrogenous base found in all RNA but not present in DNA.

Explanation:

plz mark brainliest

Answer:

Uracil

Explanation:

Uracil is a base found in RNA (but not in DNA) and derived from pyrimidine; pairs with adenine. Uracil the nitrogenous based is not found in DNA.

So, the final answer is Uracil.

Ps. Answer is B William meets Kate They both share many of the same beliefs and interests. Based on the effects of similarity on
attraction, which of the following is most likely to be William's reaction?
A William will be more likely to trust Kate than he would a stranger
B. William will be more attracted to Kate than he would a stranger.
C. William will be more likely to love Kate than he would a stranger
D. William will be more likely to distrust Kate than he would a stranger
Please select the best answer from the choices provided
A

Answers

Answer:

William will be more attracted to Kate than he would a stranger.

Explanation:

Option B is your answer choice. Have a great day ☺

On the effects of similarity on attraction, the following is most likely to be William's reaction,  William will be more attracted to Kate than he would a stranger. Thus, option "B" is correct.

How they both share many of the same beliefs and interests?

Research has found people tend to feel attracted to those who are similar to them, which is probably an evolved preference.

Still, there are several explanations for this liking. Psychologist says we believe people who are similar to us will be more likely to like us. Another reason would be that shared experiences and values make us feel more certain and positive in the world. Whatever reason it may be, the truth it psychology sees such tendency as deeply rooted in the human psyche.

Thus, option "B" is correct.

To learn more about psychology click here:

https://brainly.com/question/10980588

#SPJ2

which statement is correct about the polarity of a water molecule

Answers

Answer:

Water is Polar

Explanation:

There is no overall charge to a water molecule, but there is a slight positive charge on each hydrogen atom and slight negative charge on the oxygen atom.

Water is polar good luck

Which structure in the heart'separates
oxygenated blood from deoxygenated blood?

Answers

Answer:

pericardium

Explanation:

A double-walled membrane, the pericardium, separates the right and left chambers, preventing oxygen-rich blood from mixing up with the one without oxygen. So, the heart functions go smoothly. Deoxygenated blood enters the right atrium.

The result of a magma plume rising and decompression melting occurring may
be the formation of a small volcanic region called a(n).

Answers

Hot spot: is the answer

2. Which is an example of interspecific competition?

blue jays eating seeds from my bird feeder
white-tailed deer looking for food in a field
polar bears praying on seals in the artic ocean
squash outgrowing lettuce in my garden​

Answers

Inter specific competition occurs when two individuals compete for the same resources. Therefore the correct example would be the squash outgrowing the lettuce.

Newborn infants that are exposed to nitrate poisoning are said to be suffering from also known as .

Answers

Nitrate poisoning in newborn infants causes methemoglobinemia, also known as blue baby syndrome

Answer:

Methemoglobinemia.

Explanation:

Please help!!!
Which structure is smaller?
A. Chromosome
B. Histone
C. Nucleosome

Answers

Answer:

B. Histone because they are a family of small positively charged proteins.

Base your answers to the following question on the structures represented in the diagram.

Review Packet- Modern Genetics Name___________________________ Page 1

What is the relationship between these three structures?

Group of answer choices

Protein is composed of DNA that is stored in the cell

The cell is composed only of DNA and protein

DNA is made up of proteins that are synthesized in the cell

DNA controls the production of protein in the cell

Answers

C. DNA controls the production of protein in the cell

What is the slowest moving weather front. Why
is it so slow?

Answers

Answer:

Cold fronts

Explanation:

what is deposition ?​

Answers

Answer:

it is a geological process where sediments, soil, and rocks are added to a landform or mass

Answer:

Deposition is defined as the removal from an office or the testimony of a witness under oath. An example of deposition is the firing of a person from a government job. An example of deposition is to tell the details of the crime to an attorney before the case goes to court

Explanation:

hope this helps

1. Geologists use physical properties to identify minerals. For example, the blank

cleavage, color, fracture, hardness, luster, specific, gravity, streak, texture

Answers

Answer:

The correct answer is - crystal form (external shape).

Explanation:

Physical properties are used for the identification of the minerals that include specific gravity, streak, texture, luster color, hardness, cleavage, and crystal form.

The most common physical property of the minerals in crystal form or external shape of the mineral. This is the property of the mineral that gives an idea about the homogenous possessing a 3-D internal order.

Answer:

crystal form external shape

Explanation:

i copied lol

DNA is normally found in the nucleus as
but condenses into
during cell division.
A. histones, chromosomes
B. chromosomes, chrothatin
C. chromatin, chromosomes

Answers

Answer:

The answer is chromatin and chromosomes.

i think the answer is c

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC
9. Which amino acids would be found in the mutation protein?
Which amino acids would be found in the mutation protein

Answers

Answer:

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

Explanation:

This question is describing the process of translation, which is the second stage of protein synthesis. Translation is the process whereby a mRNA template is used to produce amino acids, which forms a sequence that will eventually become protein.

The mRNA sequence is read in a group of three nucleotides called CODON. Each codon specifies a particular amino acid. According to this question, using the genetic code table, the given DNA sequence is as follows:

DNA: CAT- TGG- CTA- ACG- TCG- ATA- ATC- GTC- GGT- AC

RNA = GUA- ACC- GAU- UGC- AGC- UAU- UAG- CAG- CCA- UG

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

Process 2 is known as

Answers

Answer:

Transcription

Explanation:

From the available diagram, process 2 converts, or transcribe or copies DNA nucleotide sequence information into RNA sequence information.

Hence, in this case, the correct answer is TRANSCRIPTION

Why human cell is consider as eukaryotic cell where as bacteria cell as prokaryotic cell?​

Answers

They do not have a nucleus or membrane organelles

Choose all the answers that apply.

Which of the following energy sources harms the
environment?

A.) coal
B.) hydroelectric power
C.) nuclear power
D.) oil

Answers

Answer:

c nuclear power because it destroy the places

Oil coal nuclear power

Decide if the following statements best describe map-based genome sequencing, best describe whole-genome shotgun sequencing, or apply equally to both sequencing methods.

a. starts with libraries of large, overlapping DNA fragments
b. starts cloning and sequencing of short, random DNA fragments
c. uses genetic recombination data to help arrange sequences correctly
d. requires sequences to be annotated after contig assembly
e. requires chromosome fragments to overlap for contig assembly
f. requires subcloning of large fragments into smaller clones for sequencing
g. is a better approach for repetitive sequences

1. Map-based genome sequencing
2. Whole-genome shotgun sequencing
3. Both sequencing methods

Answers

Answer:

1. Map-based genome sequencing: a; c; f; g

2. Whole-genome shotgun sequencing: b

3. Both sequencing methods: d; e

Explanation:

Map-based genome sequencing is a method that makes use of a reference genome sequence in order to determine the relative position of the DNA fragments before they are sequenced. This method is useful to determine the position of repetitive DNA fragments (for example, duplicated genes, repetitive non-coding regions, etc.) and Transposable Elements. Therefore, map-based genome sequencing is a suitable approach for large genomes (which are usually composed of repetitive sequences). On the other hand, in whole-genome shotgun sequencing, DNA sequences are obtained before the correct order of these DNA fragments is known. In this method, the genome is fragmented randomly into small DNA sequences (between 100 and 1000 base pairs), which are subsequently sequenced through the chain-termination sequencing approach (i.e., Sanger sequencing) and finally ordered by using bioinformatic tools that assemble overlapping reads.

Body fat in humans includes both essential and storage body fat.

a. True
b. False

Answers

Answer:

true

Explanation:

Answer:

yes that claim is actually true. those are the main fats (correct me if im wrong there)

how did natural disasters affect animal populations?​

Answers

Answer:

When disasters hit, animals experience the same terrible effects as people: injury, starvation, thirst, displacement, illness and stress. We move fast to protect animals affected by earthquakes, floods, typhoons and other disasters. We provide food, water, medical care, and other emergency assistance to animals in need

Explanation:

Which of the following statements about lichens are true?

Answers

Answer:

The photobiont supplies the association organic carbon from photosynthesis, and the mycobiont ensures protection and regulates the supply of minerals and water. The nutritional exchange between partners is probably much more complex than exchange of water and minerals for organic carbon. Thus, the correct answer is option B.

Answer:juegan maincra

Explanation:porque si

Please select the word from the list that best fits the definition

movement of molecules from an area where there are many to an area where there are few

Answers

Answer:

Diffusion

is the movement of molecules from an area where there are many to an area where there are few

Hope it helps

The process of meiosis is illustrated here. The outcome of meiosis is very important in the sexual reproduction and life cycle of
diploid organisms. Evaluate these statements and determine which ones accurately describe the outcome of meiosis. You may select
ALL that apply.
-)
A)
Meiosis produces genetically diverse cells.
B)
Meiosis increases genetic variation in the offspring.
C)
Meiosis produces haploid cells from a diploid parent cell
D)
Meiosis increases the genetic content in the daughter cells.
E)
Meiosis maintains the number of chromosomes originally present in the
parent cell.

Answers

Answer:

A) Meiosis produces genetically diverse cells.

B) Meiosis increases genetic variation in the offspring.

C) Meiosis produces haploid cells from a diploid parent cell

Explanation:

Through crossing over, meiosis produces genetically diverse cells causing more genetic variation of offspring. The Daughter cells in meiosis are formed from a diploid cell that has all 46 chromosomes, however the daughter cells are haploids as they need to join with the other gamete to have a full set of chromosomes.

Other Questions
1.)Low tide is the best feeding time for land predators such as sea gulls.TrueFalse2.)Plants are not part of food chains.TrueFalse3.) Both currents and tides are predictable patterns of movement in water.TrueFalse4.)The main benefit of an upwelling is that itcreates strong tides in coastal regionsincreases the salinity of the water in an areabrings new nutrients into an underwater regionwipes out entire ecosystems, allowing for secondary succession5.)Which of the following is true of brackish water?The salinity of the water can vary with the tides.There is usually more fresh water than salt water.Very few organisms can survive in brackish waters.It is most common in the deepest region of the ocean.6.)A high tide will occurusually only once in a 24-hour periodonly in bodies of water close to the moonon both sides of the earth at the same timewhen proximity to the sun makes the days longer7. Brackish water is most commonly found inseasriversoceansestuaries8.)All of the following are characteristics of the blue crab EXCEPTit has no natural predatorsblue crabs often feed on each otherit can adapt to varying levels of salinityit migrates to cooler temperatures as it ages9.)Unusual weather can change the tides.TrueFalse10.)Black sand can be found whentides are particularly highsediment contains volcanic ashlocal residents prefer it to light sandall the sand is washed away from the beach11.)Which of the following is a benefit of inhabiting an estuary?The water levels are consistent.The salinity levels are usually stable.There are fewer strong ocean currents.Very few predators can survive in brackish water.12.)All of the following can influence tides EXCEPTwindshurricanesheavy rainsthe shoreline13.)All of the following influence tides EXCEPTthe sunthe moonthe air temperaturethe rotation of the earth14.)The organisms that can tolerate the most time out of water would live in thespray zonehigh-tide zonemiddle-tide zonelow-tide zone15.)When the pull of the moon is strongest, tides will be lowest.TrueFalse the process of an organism adjusting to a change in an abiotic factor why does caesar tell decius he will not go to the senate The measures of the angles of a triangle are shown in the figure below. Solve for x. if you are trapped or hiding in your house for 2 years, what would you miss the most? give me five you will miss the mostFor example: nature friends etc. Find all complex solutions of the equation z-1-i=0. What is the molar mass for 5 mol Na Orden cronolgico del cuento es que somos muy pobres lo necesito hoy para porfavor ayuda alguien que me conteste bien can someone pls help me what's a 3 number multiplication that = 1000? The frequency table represents the job status of a number of high school students. A 4-column table with 3 rows titled job status. The first column has no label with entries currently employed, not currently employed, total. The second column is labeled looking for job with entries 12, 38, 50. The third column is labeled not looking for a job with entries 28, 72, 100. The fourth column is labeled total with entries 40, 110, 150. Which shows the conditional relative frequency table by column? A 4-column table with 3 rows titled job status. The first column has no label with entries currently employed, not currently employed, total. The second column is labeled looking for a job with entries 0.3, nearly equal to 0.33, 1.0. The third column is labeled not looking for job with entries 0.7, nearly equal to 0.65, 1.0. the fourth column is labeled total with entries nearly equal to 0.27, nearly equal to 0.73, 1.0. A 4-column table with 3 rows titled job status. The first column is blank with entries currently employed, not currently employed, total. The second column is labeled Looking for a job with entries 0.12, 0.38, 050. The third column is labeled not looking for a job with entries 0.28, 0.72, 1.00. The fourth column is labeled total with entries 0.4, 1.1, 1.5. A 4-column table with 3 rows titled job status. The first column has no label with entries currently employed, not currently employed, total. The second column is labeled looking for a job with entries 0.24, 0.76, 1.0. The third column is labeled not looking for a job with entries 0.28, 0.72, 1.0. The fourth column is labeled total with entries nearly equal to 0.27, nearly equal to 0.73, 1.0. A 4-column table with 3 rows titled job status. The first column has no label with entries currently employed, not currently employed, total. The second column is labeled looking for job with entries 0.08, nearly equal to 0.25, nearly equal to 0.33. The third column is labeled not looking for a job with entries nearly equal to 0.19, 0.48, nearly equal to 0.67. The f f(x) = 3x + 5 g(x) = 4x2 2 h(x) = x2 3x + 1 Find f(x) g(x) h(x) The expansion of the mongol empire most directly led to which political developments in afro-eurasia? Which of these is NOT an example of lateral surface area? A. The label of a soup can. B. Painting the walls of your bedroom. C. The paper wrapper of an ice cream cone. D. The air in a basketball CAN SOMEONE PLZ ANSWER THIS ITS DUE AT 11:59 APRIL 11 2021 AND ILL MARK U BRAINLIST ADESee your levels()) Luca has already baked 17 pies, and he can bake 4 pies with each additional cup ofsugar he buys. How many additional cups of sugar does Luca need in order to bake a totalof 45 pies?additional cups of sugarSubmit For most of human history, people used agriculture.TrueFalse PLEASE HELP MEEEEE YOU WILL GET THE BRAINELIST PLEASE WRITE A SUMMARY ABOUT THE LAW OF UNIVERSAL GRAVITATION Jesus rose from the dead on the third day after the Crucifixion.True False How can living things be classified? What are the criteria?