Atoms from sugar molecules may combine with other elements via chemical reactions to form other large carbon-based molecules

Answers

Answer 1

Answer:

Yes.

Explanation:

Yes, carbon atoms from sugar molecules combine with other elements through chemical reactions to form other large carbon-based molecules. Sugar molecules comprise of carbon, hydrogen, and oxygen atoms. The hydrocarbon of sugar molecules are used to make amino acids and other carbon-based molecules that can be combine into larger molecules such as DNA molecule.


Related Questions

The five factors that can lead to evolution are gene flow, genetic drift, mutation, natural selection, and __________.

emigration
immigration
sexual selection
controlled mating

Answers

Explanation:

controlled mating is the correct one.

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries

A morning glory has a {BLANK}
form of corona.

Answers

Answer:

I think the answer is

A morning glory has a risen form of corona

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

Identify and explain one aspect of your public speaking skills that you can improve. How can you work to improve this aspect?

Answers

Answer:

improve not moving around when you talk

Explanation:

being loud and projecting your voice is a hug part of public speaking

List one way that mitosis and meiosis are similar
and 1 way they are different.

Answers

The difference they have is mitosis produces two daughter cells with the same number of chromosomes as a parent cells. How they are alike is they are two type of cell divisions and associated with cytokinesis.

Which of the following is/are true about energy? (Select all that apply)
energy is only found in fuels
energy cannot be recycled
energy is never destroyed
energy changes form

Answers

Answer:

1 is wrong. 2 is right. 3 is true. 4 is true.

Explanation:

Energy can never be destroyed.

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

Which of the following is evidence that cells no longer respond to external factors and may have turned cancerous?

A. New cells replace old or damaged cells.
B. Cell clumps form, crowding existing cells.
C. Dead cells are shed at a more rapid rate.
D. Dormant cells re-enter an active cell cycle.

Answers

Answer:

option C will be the correct answer

Dead cells are shed at a more rapid rate is evidence that cells no longer respond to external factors and may have turned cancerous.

What are the cancer cells?

Cancer cells are defined as cells which divide continually, forming solid tumors or flooding the blood with abnormal cells. Cell division is a normal process used by the body for growth and repair.

Sometimes this orderly process breaks down, and abnormal or damaged cells grow and multiply when they shouldn’t. These cells may form tumors, which are lumps of tissue.

For more information regarding cancer cells, visit:

https://brainly.com/question/373177

#SPJ2

Over time, data that support the successful evolution of a species would include observations that describe

Answers

More body cells and more genetic changes happening

What are the products of photosynthesis?

Answers

Answer:

The reactants for photosynthesis are light energy, water, carbon dioxide and chlorophyll, while the products are glucose (sugar), oxygen and water.

Explanation:

This is where I got the information:

sciencing.com/reactants-products-equation-photosynthesis-8460990.html

I hope this helps!

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

¿Cual es la importancia biológica de los estímulos umbrales?

Answers

Answer:

En electrofisiología, el potencial umbral es el nivel crítico al que debe despolarizarse un potencial de membrana para iniciar un potencial de acción.

Explanation:

En neurociencia, los potenciales de umbral son necesarios para regular y propagar la señalización tanto en el sistema nervioso central (SNC) como en el sistema nervioso periférico (SNP).

Espero que esto ayude :))

Which animals have adapted to near-freezing water?

1. whales
2. animals in coral reefs
3. barnacles
4. fishes in polar areas

Answers

The answer would most likely be whales

Answer:

whales

Explanation:

Which statement describes the proper procedure for identifying an organism by using a dichotomous key?

Answers

Explanation:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts".


a. What information could be useful to include in a warning on an e-cigarette ad?

Answers

Maybe the dangers that e-cigarettes can have. A warning that they’re addictive and contain nicotine.

To review, what are the three main types of symbiotic relationships?
A. mutualism. commensalism, and parasitism

B. mutualism, community, practice

C. membership, commensalism, property

Answers

Answer:

A

Explanation:

The three main types of symbiotic relationships are mutualism, commensalism and parasitism

is the A is the one that has the most logic to your question

Select the correct answer.
There was an overuse of fertilizers in William's farm. This led to the destruction of the crops, and William incurred huge losses. Which
management function was neglected in this process?
OA. organizing
OB. staffing
OC. planning
OD directing
O E. controlling

Answers

Answer:

OB. staffing

20 POINTS!!!
PLEASE HELP
lmk if you can’t read!

Answers

Answer:

1. Flinch eats the Sun's energy.

2. Fox

3. 6

4. The snake is a secondary predator, while the flinch is a producer.

5. The fox and (bird next to fox name)

Explanation:

a scientific ________ is based on the results of numerous experiments.

Answers

Answer:theor

Explanation:

b

An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?

Answers

Answer:

True

Explanation:

As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.

Hence, the given statement is true

Help please! I haven't read The Immortal Life of Hennrietta Lacks and need help with this! Due today!

Answers

I honestly don’t know what book this is but I will read it it’ll prolly take 3 hours but I’ll come back

A man is HH for a trait, while his wife is hh. What will their children

Answers

Explanation:

I hope what I have drawn on the picture will help you understand:)

GIVING AWAY 14 POINTS PLEASE HELP ME ON THIS QUESTION ASAP!!!!

Answers

Answer: i think its B or C

Answer: B

Explanation: Hope this help :D

8 amino acide are coded by _______ amino acids?

Answers

Answer:

Explanation:

nutrients i think im not sure sorry sweetheart

hello please help i’ll give brainliest

Answers

Atmosphere is the correct answer!

Answer: Atmosphere

Explanation: It isthe envelope of gases surrounding the earth and protect it

The antlion is a ______

Answers

Explanation:

Antlion, (family Myrmeleontidae), any of a group of insects (order Neuroptera) that are named for the predatory nature of the larva, which trap ants and other small insects in pits dug into the ground. Antlions are found throughout the world, primarily in dry, sandy regions.

Humans depend on the biodiversity of living things for all of the
following EXCEPT

A. Weather
B. Food
C.medicine
D.shelter

Answers

The answer to your question is c!
answer should be A
hope this helps :)
Other Questions
why were the Creek Indians angry when they picture of Chief William McIntosh 25. A car with mass M traveling at speed V has kinetic energy K. What is the kinetic energy of a second car that has the 1/4 times the mass M (1/4 smaller) and twice the speed V (2 x larger) ofthe first car? O 2KOK08KO 4K whats does 7 correspond to . please help . Speculate how mutations cause changes that can then be seen over many generations. 30 grams FO2 to molecules hi please help me im sorry its just i need this so bad explain how Macbeth's attemptto resolve his conflict changes him. What message does Shakespeare conveythrough his change? Act I, Scene 3, lines 130-142; Scene 7, lines 31-35Act II, Scene 2, lines 56-61 Act III, Scene 4, lines 93-96; lines 122-126Act V, Scene 3, lines 1928; Scene 5, lines 9-15 1. Cuando necesito pollo o bistec voy a la ___. *carniceradulcerajoyerapeluquera2. Quiero comprar una silla nueva en la ___. *floreraheladerajugueteramueblera3. Vamos al banco para pedir ___ dinero para comprar una casa. *baratoliquidacinprestadovendedor4. Luisa no tiene dinero para ir de compras pero le gusta mucho mirar ___ en el centro comercial. *caromonedasprestadovidrieras How do plants acquire necessary nutrients?from the sunfrom the airthrough the plant leavesthrough the plant roots The balance sheet of Cranium Gaming reports total assets of $380,000 and $680,000 at the beginning and end of the year, respectively. Sales revenues are $1.30 million, net income is $63,000, and operating cash flows are $54,000. Calculate the cash return on assets, cash flow to sales, and asset turnover for Cranium Gaming. (Enter your answers in dollars, not millions (i.e., $10.1 million should be entered as 10,100,000).) Please help with this geometry question ASAP. Also please show work Patents and copyrights are considered to be what type of resource?A. Structural/culturalB. physicaloC. intangibleD. financial The following table gives annual life insurance premiums per $1,000 of face value. Use the table to determine the face value of a 10-year term insurance policy on a 25-year-old female given that the annual premium for the insurance policy is $384.59. If need be, round your answer to the nearest cent. Term Insurance Age 5-Year Term 10-Year Term Male Female Male Female 20 $2.07 $4.20 21 22 23 24 $2.43 2.49 2.55 2.62 2.69 2.77 2.15 2.22 2.30 2.37 2.45 $4.49 4.57 4.64 4.70 4.79 4.29 4.36 4.42 4.47 25 4.85 4.51 C $80,290.19 b. SB6,038,03 $85,274.94 $79,296.69 When 3 subtract from one third of a number n, the result is less than 6. Whitehall inequality and solution represent this situation? The base of a ladder is placed 5 feet away from a 10-foot-high wall, so thatthe top of the ladder meets the top of the wall. What is the measure of theangle formed by the ladder and the ground? Round nearest degreeA10 ft63 degreesO 79 degreesO 73 degrees68 degrees which continent of Ancient Rome would be the easiest to travel to and why? E09 ReviewScores on "The ability to do quantitative thinking" test are normally distributed with a mean of 250 and a standard deviation of25. Brandi scored at the 81st percentile on this test. What was her test score?is the test score for Brandi. Penny's mom has 5 children.The 1st kid is named January.2nd kid is February.Her 3rd is called March.4th is April.What is the name of the 5th. PLEASE HELP ME ON MY FIRST QUESTION!, SHOW WORK PLEASE!! Please help I don't understand.