Article VI of the US Constitution says that the Constitution is the “__________ Law of the Land.”
A.
Supreme
B.
Reserved
C.
Delegated
D.
Concurrent



Please select the best answer from the choices provided
please help me

Answers

Answer 1

Answer:

Its A

Explanation:

Article VI Of The US Constitution Says That The Constitution Is The __________ Law Of The Land.A.SupremeB.ReservedC.DelegatedD.ConcurrentPlease

Related Questions

WEEK force work inclined plane simple machine distance Chandra needed to carry a heavy box up a flight of stairs. To make the require less effort, she made a ramp. This ramp, or was a board that she laid over the steps. It was an example of a​

Answers

Answer: Is that a question?

Explanation:

Two other criteria that are required in order to be considered bachelor studies

Answers

Answer: Pre requisite subjects. This is a must to have requirement. ...

Merit based. This is also a must to pass requirement.

Explanation:

Two criteria for the bachelor studies are:

You meet the school requirements.You are able to pass the entrance.

What is a Bachelors degree?

This is a degree that is offered by a university to students after they have completed their course of learning.

The Bachelors degree is awarded following the fact that the student have passed all required courses.

Read more on bachelors degree here:https://brainly.com/question/17496239

why did other city-state both fear and admire sparta​

Answers

Answer:

Sparta had an astounding military force, as well as fearless leaders.

Explanation:

NEED TO GET SOME CIVICS IN. LITERALLY DONT DO HOMEWORK CUZ I CANT LEAVE MY BED PLEASE HELP!

Many American have become addicted to prescription pain drugs called opioids. Governments are looking for solutions
to this problem.
Why might policymakers in different regions have different perspectives on this issue?

Opioid addiction is not as serious a problem as some policymakers think.

Opioid addiction has affected people in some parts of the country more than others.

Health issues are considered public policy and are not important in many parts of the country.

Some people believe this problem is better decided by state governments rather than the federal government

Answers

Answer:

Opioids, sometimes called narcotics, are a type of drug. They include strong prescription pain relievers, such as oxycodone, hydrocodone, fentanyl, and tramadol. The illegal drug heroin is also an opioid. Some opioids are made from the opium plant, and others are synthetic (man-made).

A doctor may give you a prescription opioid to reduce pain after you have had a major injury or surgery. You may get them if you have severe pain from health conditions like cancer. Some doctors prescribe them for chronic pain.

Opioids can cause side effects such as drowsiness, mental fog, nausea, and constipation. They may also cause slowed breathing, which can lead to overdose deaths. If someone has signs of an overdose, call 911:

The person's face is extremely pale and/or feels clammy to the touch

Their body goes limp

Their fingernails or lips have a purple or blue color

They start vomiting or making gurgling noises

They cannot be awakened or are unable to speak

Their breathing or heartbeat slows or stops

Other risks of using prescription opioids include dependence and addiction. Dependence means feeling withdrawal symptoms when not taking the drug. Addiction is a chronic brain disease that causes a person to compulsively seek out drugs, even though they cause harm. The risks of dependence and addiction are higher if you misuse the medicines. Misuse can include taking too much medicine, taking someone else's medicine, taking it in a different way than you are supposed to, or taking the medicine to get high.

Opioid misuse, addiction, and overdoses are serious public health problems in the United States. Another problem is that more women are misusing opioids during pregnancy. This can lead to babies being addicted and going through withdrawal, known as neonatal abstinence syndrome (NAS). Opioid misuse may sometimes also lead to heroin use, because some people switch from prescription opioids to heroin.

The main treatment for prescription opioid addiction is medication-assisted treatment (MAT). It includes medicines, counseling, and support from family and friends. MAT can help you stop using the drug, get through withdrawal, and cope with cravings. There is also a medicine called naloxone which can reverse the effects of an opioid overdose and prevent death, if it is given in time.

To prevent problems with prescription opioids, be sure to follow your doctor's instructions when taking them. Do not share your medicines with anyone else. Contact your doctor if you have any concerns about taking the medicines.

Explanation: is it close it took a long time to type this

Show Detai
Late
St. Patrick's Day Movie
Which of the following is an example of a secular holiday?
2
A
Christmas
B
Hanukkah
c
the fourth or july
d
easter

Answers

Answer:

The answer to this question is c.

Explanation:

hope this helps

. What are some examples of how Roman philosophy and law influence us today?

Answers

Answer:

Roman philosophy and law affect modern life in several ways. Today, we describe someone who bears pain and suffering bravely as stoic. Some modern law codes in Europe are based on Roman laws. The U.S. Declaration of Independence and the U.S. Constitution are based on some Roman ideas.

Explanation:

Hope it helps! Correct me if I am wrong

Im sure about my answer :>

If you dont mind can you please mark me as brainlest?

2.What is a mark-up?


Money added to the original price

Money subtracted from the original price

Money that is borrowed by you to be paid back over time

Money that is deposited into an account

Answers

Answer:

sksjejeme

Explanation:

938ejemeeuuhj

Other Questions
Was there a contradiction between Balfours proposal to establish a national home for the Jewish people and the promise that nothing shall be done which may prejudice the civil and religious rights of existing non-Jewish communities in Palestine? If so, why did he make two contradictory promises? argumentative essay on genetically modified foodsCAN SOMEBODY HELP ME WITH DIS PLZZ DONT PUT ANYTHANG SLOW PLZZ help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks. If 2 cups makes 6 servings, how much makes 2 servings? shawtys been simping for so long.. do you think hunter-gatherers are still around today? what makes you think that? Hi, I am very stuck on questions 17 and 18. Can someone help please? Thanks In which quadrant does the point with c ordinate (4, -3) lie?