are trees producers?

Answers

Answer 1
In the forest's ecosystem, the trees, shrubs and moss are all producers. They turn water and sunlight into the energy they need to live and grow, through a process called photosynthesis.

Related Questions

What are the products of photosynthesis?

Answers

Answer:

The reactants for photosynthesis are light energy, water, carbon dioxide and chlorophyll, while the products are glucose (sugar), oxygen and water.

Explanation:

This is where I got the information:

sciencing.com/reactants-products-equation-photosynthesis-8460990.html

I hope this helps!

PLEASE HELP JUST MATCH THEM UP

BRAINIEST ANSWER!!!

Answers

Explanation:

71% of the Earth----All of water on Earth

97%of water on Earth----- Salt water

77%of the freshwater on Earth------Frozen in Glaciers

22% of fresh water on Earth----- water Underground

The biological selection of a particular allele for a trait to be passed to offspring has nothing do with the selection of the allele for another trait. Which of the following supports this statement?​

Answers

Answer:

1

Explanation:

Apply what you know about lipids to explain why the cuticle helps prevent water loss in plants. Compare it to what humans do.

Answers

Answer:

Explanation:

Waxy cuticle is a white powdery substance that is insoluble, it is found usually on the surface of stem or leave and it prevent excessive loss of water through transpiration.

It is an adaptive mechanism used in dry areas or desert to help plants retain water that is needed for their growth by reducing amount of water loss through transpiration.

Cactus is an example of plant with cuticle that thrive well in dry areas

Examine the photograph. Identify at least three natural resources being used. Describe where each natural resource came from.

Answers

Answer:

Water- from water comes from a variety of sources, including many of the same sources as tap water.

Leather- from rawhide and skins. The most common raw material is cattle hide.

plastic- from cellulose, coal, natural gas, salt and crude oil through a polymerisation or polycondensation process

Explanation:

<3

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

20 POINTS!!!
PLEASE HELP
lmk if you can’t read!

Answers

Answer:

1. Flinch eats the Sun's energy.

2. Fox

3. 6

4. The snake is a secondary predator, while the flinch is a producer.

5. The fox and (bird next to fox name)

Explanation:

1. The process of translation is responsible for producing which type of molecule?

A. Polypeptide
B. RNA strand
C. DNA strand
D. New gene


Answers

rna strand im pretty sure

Find a recent article that is centered around life science and give a report about it.....answer these 3 questions: 1) How is this article related to life science? 2) What interesting information did you read about in this article? 3) Why would this article be important for others to read?

Answers

I think the answer is A but I’m not sure have a great day buddy let me know if I can help with anything else

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

Humans depend on the biodiversity of living things for all of the
following EXCEPT

A. Weather
B. Food
C.medicine
D.shelter

Answers

The answer to your question is c!
answer should be A
hope this helps :)

An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?

Answers

Answer:

True

Explanation:

As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.

Hence, the given statement is true

As fast as you can, name the planets in order from the sun.

Answers

Answer:

Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus, Neptune

Explanation:

Thenks and mark me brainliest :))

Answer: mercury, Venus, earth mars, Jupiter, Saturn, Uranus, Neptune,

and 15 years ago Pluto

Explanation: i should get extra for saying pluto

To review, what are the three main types of symbiotic relationships?
A. mutualism. commensalism, and parasitism

B. mutualism, community, practice

C. membership, commensalism, property

Answers

Answer:

A

Explanation:

The three main types of symbiotic relationships are mutualism, commensalism and parasitism

is the A is the one that has the most logic to your question


Which of the following is a way in which the atmosphere does NOT
interact with the hydrosphere? *
A). Decreasing the salinity of oceans from increased temperatures causing glacial
melting.
B). Developing hurricanes over warm ocean currents.
C).Increasing the amount of water evaporation from oceans and global temperatures
rise.
D). Gases moving sediment from hill tops

Answers

The correct answer is d. Please give me brainlest let me know if it’s correct or not okay thanks bye

what're the two body systems opossums use to fake their death?

Answers

Apparent death, colloquially known as playing dead, feigning death, or playing possum, is a behavior in which animals take on the appearance of being dead. This form of animal deception is an adaptive behavior also known as tonic immobility or thanatosis. Apparent death can be used as a defense mechanism or as a form of aggressive mimicry, and occurs in a wide range of animals.

When induced by humans, the state is sometimes colloquially known as animal hypnosis. According to Gilman et al.,[1] the investigation of "animal hypnosis" dates back to the year 1646 in a report by Athanasius Kircher.

Opossums do not virtually play lifeless whilst they are threatened. Instead, they involuntarily input a catatonic kingdom.

Opossums, as they're generally called, are much more likely to run the alternative way, uncover their tooth, and growl in risky situations.

Playing dead is an involuntary reaction at the a part of the opossum. The strain of the war of words going through the opossum reasons him to enter surprise. This surprise induces a comatose kingdom that may remain for forty minutes.

Why ringtail Opossums don't play dead.

No, ringtail Opossums they do not, they make a sound, you could concentrate on it on the subsequent post: Strange Australian Back Garden Beastie Sounds.

Therefore it is clear that they play dead by unover their tooth and growling in risky situations.

To learn more about opossums refer to the link;

https://brainly.com/question/1056658

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries

NO LINKS! NO PDF'S! NO FILES! JUST ANSWER!!! PLEASE HELP ASAP

Answers

(1. Physical adaptation (2. Behavioral ( 3. physical adaptation (4.behavioral (5. physical (6. behavioral (7. physical (8. behavioral (9. physical (10. behavioral (11. behavioral (12. behavioral

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

Identify and explain one aspect of your public speaking skills that you can improve. How can you work to improve this aspect?

Answers

Answer:

improve not moving around when you talk

Explanation:

being loud and projecting your voice is a hug part of public speaking

Cuando se excita una neurona con estímulos de intensidad creciente se obtiene, a partir del umbral, la misma respuesta eléctrica. En esta situación se pone de manifiesto la característica de: *
A) ley del todo o nada.
B) período refractario relativo.
C) período refractario absoluto.
D) excitabilidad.
E) umbral de excitación.

Answers

Answer:

d) excitabilidad

Explanation:

creo que seria esa no lo sé

no se mucho de eso

me dices si sale buena o mala

a scientific ________ is based on the results of numerous experiments.

Answers

Answer:theor

Explanation:

b

Over time, data that support the successful evolution of a species would include observations that describe

Answers

More body cells and more genetic changes happening

PLEASE HELP! WILL GIVE BRAINLIEST. Describe the contribution of photosynthesis and cellular respiration to the exchange of carbon between the atmosphere and the biosphere.

Answers

Cellular respiration and photosynthesis are essential to the carbon cycle because cellular respiration involves the intake of oxygen o2 and the exhale of carbon-dioxide co2 into the atmosphere. Where photosynthesis uses the carbon dioxide and water to create oxygen and sugars through energy to repeat the cycle. Respiration in general is a process where carbohydrates are turned into dihydrogen monoxide or water and co2(carbon dioxide). Living organisms together throughout the biosphere and atmosphere work together to continue this because carbon itself is an organic substance.

Answer:

Explanation:   Cellular respiration and photosynthesis are important parts of the carbon cycle. The carbon cycle is the pathways through which carbon is recycled in the biosphere. While cellular respiration releases carbon dioxide into the environment, photosynthesis pulls carbon dioxide out of the atmosphere.

¿Cual es la importancia biológica de los estímulos umbrales?

Answers

Answer:

En electrofisiología, el potencial umbral es el nivel crítico al que debe despolarizarse un potencial de membrana para iniciar un potencial de acción.

Explanation:

En neurociencia, los potenciales de umbral son necesarios para regular y propagar la señalización tanto en el sistema nervioso central (SNC) como en el sistema nervioso periférico (SNP).

Espero que esto ayude :))

based on questions 6 , 7 or 8 what happens to the voltage required in a circuit as the resistance decreases ? increases ?

Answers

Answer:

As the resistance decreases the Voltage Increases

Explanation:

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

Which of the following statements is true. *
10 points
Sperm : Produced in ovaries Eggs: Produced in testes
Sperm: Produced in testes Eggs: Produced in ovaries

Answers

Answer:

sperm produced in testes, Eggs produced in ovaries

what is the botanical name of milk​

Answers

Answer:

Milk of magnesium's scientific name is magnesium hydroxide, and the scientific name for milk of sulfur is precipitated sulfur.

The botanical name of milk is not applicable, as it is not a plant or a plant product. Botanical name is the scientific name given to plants, fungus and algae.

Milk is a nutrient-rich fluid produced by mammals. It is frequently consumed as a source of nutrients and is renowned for having a lot of calcium. Water, lipids, proteins, carbs, vitamins, and minerals are all present in milk in complicated proportions.

There is no particular botanical name for milk in the field of biology, which is the study of plants and their categorization. Different plant species are identified and categorized using botanical names.

Milk lacks a botanical name since it is a byproduct of animals, not plants.

Learn more about botanical names here:

https://brainly.com/question/20532715

#SPJ6

Other Questions
This is the paragraph please help!! An illustration is another graphic aid that can be very helpful to a reader. An illustration can tell about the characters, theaction and the setting in a story. It can also clarify the content of a text. An illustration may reveal the content of a text bypicturing an animal people, or other story elements. Illustrations can alert you to a problem in the story, such sa boy lostIn a storm. Illustrations help us to visualize and understand what we are reading.Good Illustrations can add descriptive details to a story. An old proverb says, "One picture is worth a thousand words." Theboy in the next illustration is the main character in the story. Can someone please help me I will mark u brilliant for both answers Part A What can be inferred about the story adapted fromBookIXfromThe Odyssey? Odysseusdoes not have faith in his own escape plan. Odysseus does not always have good judgment. Odysseusdoes not want to hurt the Cyclops. Odysseusdoes not want his men to rescue him. Question 2 Part B Which evidence from the storybestsupports the answer to Part A? "In his rage, he ripped off the top of a mountain and hurled it toward the sound of Odysseuss voice." "Odysseus signaled for them to hush. He realized that they were still in range of the Cyclopss hearing." "As the last sheep went out, the fine ram concealing Odysseus, the Cyclops grabbed hold of the animal." "The soldiers advised against this, but Odysseus insisted." Why did Tex feel like he'd like to kill everyone in the room?Book called Tex by SE Hinton What are the two main divisions of the nervous system called? Decide if the following sentence is grammatically CORRECT or INCORRECT.Venga conmigo.CorrectIncorrect Which option identifies what Melanie can eat in the following scenario to fill the void in her food pyramid?Melanie does not eat red meat or chicken because she disagrees with the practices used to get them to market. She needs to get more protein in her diet.bean and pea saladwhole grain pasta with shrimpavocado slices and cornspinach and cheese enchilada I need answers quick. ASAP. find the product of the complex numbers.express your answer in trigonometric formz1=7(cos15+isin15) z2=2(cos110+isin110) NO LINKS PLEASE, NEED ANSWER ASAP What will happen to a plant cell placed in distilled water?The cell will become flaccid due to the cell membrane.The cell will become turgid due to the cell wall.The cell will lysis due to the cell membrane.The cell will burst due to the cell wall. Solve the volume of the cylinder 3m 10m Question 2 of 10What is the length of the x component of the vector shown below? A. 3B. 0C. 5D. 1 Which one is an example of an answer that has one solutions? * At a local basketball game, all tickets are the same price and all souvenirs are the same price. Mr. Smith bought 2 tickets to this basketball game and 1 souvenir fora total of $17.25. Ms. Lockhart bought 5 tickets to the same game and 2 souvenirsfor a total of $42.00. How much was a ticket to this game? Which statement describes an electrolyte? 3) Six teams are playing in a baseball tournament. In how many ways can the teams be crowned champion andrunner-up? Which of the following is a true statement about the economic development ofnations? Please help me answer this! If you had ever had this question... btw this question only has one answer. PLEASE HELP ASAP An important problem in industry is shipment damage. A electronics distribution company ships its product by truck and determines that it cannot meet its profit expectations if, on average, the number of damaged items per truckload is greater than 12. A random sample of 12 departing truckloads is selected at the delivery point and the average number of damaged items per truckload is calculated to be 9.4 with a calculated sample of variance of 0.64. Select a 99% confidence interval for the true mean of damaged items.a) [48.26, -30.02]b) [10.67, 11.93]c) [-0.6285, 0.6285]d) [10.69, 11.91]e) [11.37, 12.63]f) none of the above Seamus plays outside for five and five sixths hours every week. He has already played outside for four and three sixths hours. How many hours does he have left to play?A.1B. 1 1/4C. 1 2/6D. 1 4/6