An unknown element has two isotopes. The first isotope has a mass of 68.926 amu and an abundance of 60.108%. The second isotope has a mass of 70,925 amu and an abundance
of 39.892%. Calculate the average atomic mass AND identify the element.

Answers

Answer 1

Answer:

69.72344108

Gallium

Explanation:

Answer 2

M
r
(
G
a
)
=
69.7231
to 4 decimal places
.
Explanation:
To find the average atomic mass (
A
r
) of an element, given the percentage rarities of its isotopes, simply multiply each isotope's
A
r
by its percentage that is expressed as a decimal and total the results. We can carry this out in a single line of working:
M
r
(
Ga
)
=
(
68.9256

0.60108
)
+
(
70.9247

0.39892
)

M
r
(
Ga
)
=
69.7231
to 4 decimal places

Similarly, you could input the percentages normally and then divide by
100
:
M
r
(
Ga
)
=
(
68.9256

60.108
)
+
(
70.9247

39.892
)
100

M
r
(
Ga
)
=
69.7231
to 4 decimal places

Notice that the answers are the same. Also observe that the answer is closer to 69 than it is to 71, which makes sense since gallium-69 makes up a greater proportion of gallium in the universe (
~
60
%
) than gallium-71 does (
~
30
%
)

Related Questions


A bucket is filled with pebbles and water. How can the contents of the bucket be classified?

A. A compound
B. A heterogeneous mixture
C. A solution
D. A homogeneous mixture

Answers

B.A heterogeneous mixture
Heterogeneous mixture

what are the 3 things needed in photosynthesis​

Answers

Answer:

Carbon dioxide, water and light are all needed for photosynthesis to take place. Photosynthesis happens in the leaves of a plant.

Explanation:

Helppp. Calcium reacts with bromine to form Calcium bromide
Ca - - - - > Ca+2

Br2 - - - - > 2br

A. Complete the equation by adding electrons

Answers

[tex]\mathfrak{\huge{\pink{\underline{\underline{AnSwEr:-}}}}}[/tex]

Actually Welcome to the Concept of the Chemical Bonding.

Since we know that, calcium shares 2 electrons and Bromide being a halogen accepts 1 electron at a time,

So 2 bromides combine together to form a bond with Calcium, so we get as,

Ca2+ + 2Br -----------------------> CaBr2

CaBr2 is the compound formed.

Choose all the answers that apply.

What are the habits of mind that a scientist must possess?

creativity
skepticism
artistic ability
reasoning
bias

Answers

Answer:

Creativity

Skepticism

Reasoning

Explanation:

Scientists must see a creative way to solve problems in the world. Scientists must also be skeptic about what is said, because if they were not, no one would disagree and the problems would never be solved. Reasoning is a must, as reasoning is involved in the scientific process and writing conclusions to their studies.

Hope this help!

Based on the kinetic molecular theory (KMT), which statement is true?
The particles of matter are do not move.
Matter is composed of very small particles.
The particles of matter have zero kinetic energy.
Matter is made up of only charged particles.

Answers

Statement 1 is false because heat is the movement of molecules.

Statement 2 is true because matter is composed of elementary particles which are VERY small.

Statement 3 is false because the kinetic energy of a particle determines its heat and it is impossible for a particle to be completely motionless.

Statement 4 is false because neutrons do not have a charge and make up a large portion of all matter.  

which three elements have the most similar chemical properties

Answers

Answer:

K, Rb and Cs

Explanation:

Answer:

krypton, bromine, and argon

How do we exist? What does scientific evidence suggest about the start of the universe?

Answers

Answer:

It all started with the big bang.

The big bang is how astronomers explain the way the universe began. It is the idea that the universe began as just a single point, then expanded and stretched to grow as large as it is right now (and it could still be stretching).

10g of an oxide of copper contains 8.882g of copper. what is empirical formula of the copper oxide

Answers

Answer:

Mass of copper oxide: 10g

Mass of copper: 8.882g

Mass of oxygen: 1.118g

                                                                Cu               O

                                                              8.882           1.118

Divide by [tex]A_{r}[/tex]                                   8.882÷63.5       1.118÷16

                                                               0.14             0.07

Divide by the lowest number          0.14/0.07       0.07/0.07

                                                                  2                  1

Check the ratio now, Cu has 2 atoms and O has 1 atom .

The formula is [tex]Cu_{2} O[/tex]

Which of the following correctly describes solid, liquid, and gas states of matter?

Answers

Explanation:

In solids, the particles are tightly packed together. In liquids, the particles have more movement, while in gases, they are spread out. Particles in chemistry can be atoms, ions or molecules. It is important to understand the particle nature of matter.

Which Respiratory organ is responsible for giving oxygen to the bloodstream?

-Bronchi
-Trachea
-Alveoli
-or Larynx?

Answers

Answer:

I think that it is Trachea

Montrel takes a trip to Central America during the winter. He finds out that the temperature in Central America is about the same year round. Which of the following could explain why?
Options:
A: Central America is near the North Pole.
B: Central America is near the South Pole.
C: Central America is near the equator.
D: Central America is near sea level.

Answers

Answer:

C

Explanation

Because My teacher told me that for an example Florida is hot but in Central America is cold or hot and you don’t need a jacket. I don’t remember much

The Central America is near the equator could explain the above statement.

What is equator?

Equator is an imaginary line that passes through the centre of the globe at 0 degrees latitude and at equal distance between the North and South Poles.

Some countries of Central America are situated near the equator. The places near equator have little seasonal variation. These places have same amount of daylight and darkness throughout the year and remain warmer year round. These places near the equator have an alternating dry and rainy seasons.

Hence, we can conclude that option C is the answer.

To learn more about equator here

https://brainly.com/question/18135884

#SPJ2

help me please i have it due soon

Answers

Answer:

B

Explanation:

I think it is B. That is because when you are falling, your just going to fall faster and faster.

I hope this helps!

Answer:

B

Explanation:

The third force the jumper experiences is a spring force due to the bungee cord. The amount that the bungee cord pulls back on the jumper depends on how far the cord has been stretched, i.e. the farther the jumper has fallen, the more the cord pulls back on him or her.

What evidence do we have that energy levels in an atom are quantized? State and explain the evidence.

Answers

Answer:

The first evidence of quantization in atoms was the observation of spectral lines in light from the sun in the early 1800s by Joseph von Fraunhofer and William Hyde Wollaston.

Explanation:

Describe the three mechanisms of heat flow (conduction, convection, and radiation), and the factors that influence their rates.

Answers

Answer:

Just as interesting as the effects of heat transfer on a system are the methods by which it occurs. Whenever there is a temperature difference, heat transfer occurs. It may occur rapidly, as through a cooking pan, or slowly, as through the walls of a picnic ice chest. So many processes involve heat transfer that it is hard to imagine a situation where no heat transfer occurs. Yet every heat transfer takes place by only three methods:

Conduction is heat transfer through stationary matter by physical contact. (The matter is stationary on a macroscopic scale—we know that thermal motion of the atoms and molecules occurs at any temperature above absolute zero.) Heat transferred from the burner of a stove through the bottom of a pan to food in the pan is transferred by conduction.

Convection is the heat transfer by the macroscopic movement of a fluid. This type of transfer takes place in a forced-air furnace and in weather systems, for example.

Heat transfer by radiation occurs when microwaves, infrared radiation, visible light, or another form of electromagnetic radiation is emitted or absorbed. An obvious example is the warming of Earth by the Sun. A less obvious example is thermal radiation from the human body.

:)

Further more info...

Conduction:

As  you walk barefoot across the living room carpet in a cold house and then step onto the kitchen tile floor, your feet feel colder on the tile. This result is intriguing, since the carpet and tile floor are both at the same temperature. The different sensation is explained by the different rates of heat transfer: The heat loss is faster for skin in contact with the tiles than with the carpet, so the sensation of cold is more intense.

Convection :

In convection, thermal energy is carried by the large-scale flow of matter. It can be divided into two types. In forced convection, the flow is driven by fans, pumps, and the like. A simple example is a fan that blows air past you in hot surroundings and cools you by replacing the air heated by your body with cooler air. A more complicated example is the cooling system of a typical car, in which a pump moves coolant through the radiator and engine to cool the engine and a fan blows air to cool the radiator.

Radiation :

You can feel the heat transfer from the Sun. The space between Earth and the Sun is largely empty, so the Sun warms us without any possibility of heat transfer by convection or conduction. Similarly, you can sometimes tell that the oven is hot without touching its door or looking inside—it may just warm you as you walk by. In these examples, heat is transferred by radiation. That is, the hot body emits electromagnetic waves that are absorbed by the skin. No medium is required for electromagnetic waves to propagate. Different names are used for electromagnetic waves of different wavelengths: radio waves, microwaves, infrared radiation, visible light, ultraviolet radiation, X-rays, and gamma rays.

In going across a row of the periodic table, protons and electrons are added and ionization energy generally increases. In going down a column of the periodic table, protons and electrons are also being added but ionization generally decreases. Explain.

Answers

Answer:

Explanation:

Ionization energy:

It is the minimum amount of energy required to remove the electron from isolated gaseous atom to make the ion.

As we move from left to right across the periodic table the number of valance electrons in an atom increase. The atomic size tend to decrease in same period of periodic table because the electrons are added with in the same shell.

When the electron are added, at the same time protons are also added in the nucleus. The positive charge is going to increase and this charge is greater in effect than the charge of electrons. This effect lead to the greater nuclear attraction. The electrons are pull towards the nucleus and valance shell get closer to the nucleus. As a result of this greater nuclear attraction atomic radius decreases and ionization energy increases because it is very difficult to remove the electron from atom and more energy is required.  Where as,

When we move down the group atomic radii increased with increase of atomic number. The addition of electron in next level cause the atomic radii to increased. The hold of nucleus on valance shell become weaker because of shielding of electrons thus size of atom increased.

As the size of atom increases the ionization energy from top to bottom also  decreases because it becomes easier to remove the electron because of less nuclear attraction and as more electrons are added the outer electrons becomes more shielded and away from nucleus.

How do nicotine and tobacco cause cancer?

Answers

Answer:

by damaging or changing a cell's DNA

Explanation:

How cab yout knowledge about solutions help improve health or the quality of life? In what practical way can you use your knowledge about it? ​

Answers

Answer:

Here are possible ways to improve health and quality of life:

-Exercise almost everyday

-Be more positive

-Get rid of bad habits

-Start good habits

-Get new things

-Learn New things

The_____
is an organelle that can give instructions for a
cell to reproduce and send directions to organelles to make needed
materials.

Answers

Answer:

nnmnm

Explanation:

I WILL GIVE U BRAINLIEST

Which word best replaces reach without changing the meaning of the sentence?

I can't help you because your request is beyond the reach of my department.


guidelines

purview

discretion

outreach

Answers

I believe the answer would be purview, as its definition is “the scope of the influence or concerns of something.” It would be regarded as the capabilities of of that department. Please mark as Brainliest answer! :-)

Purview is the word that best replaces reach without changing the meaning of the sentence. Therefore, the correct option is option B.

What is statement?

A sentence is indeed a collection of words used to express a thought. A sentence always begins with such a capital letter then concludes with a period, punctuation mark, and exclamation point. Ideal sentence construction has a verb and a subject. Declarative sentences make a declaration, express an opinion, or make an emotion known.

Declarative sentences have a period at the end. Questions are asked in sentences known as interrogatives. These phrases are followed by a question mark. This kind of phrase is used to give instructions or make a request. There is typically a period at the end, but occasionally there is also an exclamation point. Univocal means having only one possible meaning. Purview is the word that best replaces reach without changing the meaning of the sentence.

Therefore, the correct option is option B.

To know more about statement, here:

https://brainly.com/question/3281093

#SPJ3

What is the atomic number, icon, mass of potassium?

This should be EASY!

Answers

Answer:

19, K, 39.098

Explanation:

Potassium is a chemical element with symbol K and atomic number 19.

Atomic Mass: 39.098u

Water is a pure substance. Which of the following is true about water?

a
A chemical change is required to separate the elements present in it.

b
A physical change is required to separate the elements present in it.

c
It is made up of two compounds, each with a different set of atoms.

d
It is made up of an element and a compound.

Answers

Answer:

A chemical change is required to separate the elements present in it.

Explanation:

The only true statement from the choices given is that water as a pure substance requires a chemical change to separate the elements present in it.

Water is a molecule consist of two atoms of hydrogen and one atom of oxygen.

The atoms are covalently bonded together. A chemical process, the electrolysis of water is often used to separate the atoms of a water. Physical changes cannot be used to separate the atoms of water. Water is a compound which consists of two elements.

Therefore, we see that only the first choice satisfies this problem.

Use the following chemical equation to answer the question:

2 K + MgBr2 ⟶ 2 KBr + Mg

Which elements or compounds are the reactants?
1. K and MgBr2
2. MgBr2 and Mg
3. KBr and Mg
4. K and KBr

Answers

Answer:

Option 1. K and MgBr2

Explanation:

From the question given above, we obtained the following data:

2K + MgBr2 —> 2KBr + Mg

In a chemical reaction, the reactants are located on the left side of the equation while the products are located on the right side.

The reactants are separated from the products by an arrow sign.

Considering the question given above,

Element /compound >>> location

K, MgBr2 >>>>>>>>>>>>> Left

KBr, Mg >>>>>>>>>>>>>> Right

From the illustration above, the reactants (i.e element/compound on the right side) are K and MgBr2

9 POINTS PLEASE HELP ASAP!!

determine the mass of butane that burned when 2.46g water were produced​

Answers

Complete combustion of Hydrocarbons with Oxygen will produce CO₂ and H₂O

Combustion of butane (C₄H₁₀) :

[tex]\tt 2C_4H_{10}+26O_2\rightarrow 8CO_2+10H_2O[/tex]

2.46 g water(H₂O) were produced​

mol of water

[tex]\tt \dfrac{2.46}{18}=0.137[/tex]

mol of butane

[tex]\tt \dfrac{2}{10}\times 0.137=0.0274[/tex]

mass of butane

MW : 58,12 g/mol

[tex]\tt mass=mol\times MW\\\\mass=0.0274\times 58.12\\\\mass=\boxed{\bold{1.592~g}}[/tex]

Use two analogies to describe quantized change.

Answers

Answer:

See explanation

Explanation:

1) A flight of stairs because there is a specific number of steps one may take at a particular time. That is, the number of steps that can be taken at a given time is not continuous.

2) The gear system of a car: The gear system of a car can only take whole number integer values. It is not continuous and only one level of gear can be attained at a given time.

The two analogies that I used to describe quantized change are;

- Notes on a Piano

- Digital Clock

Quantized change is simply means that the change is definite under certain restrictions such as the gears in our cars. This means that change comes in discreet amounts.

The 2 analogies that I can use to describe it are as follows;

1) Notes on a Piano; When we are turn on a piano, the notes on the piano are fixed and as such we can only play the notes that the keys can hit.

2) Digital clock; The representation of time in digital clocks is in terms of numbers which can be said to be discrete variables.

Read more at; https://brainly.com/question/12508919

Based on the three formulas shown, use one of them to solve for the purple yellow and red box and explain how you did it.

Answers

P = 11.133 atm (purple)

T = -236.733 °C(yellow)

n = 0.174 mol(red)

Further explanation  

Some of the laws regarding gas, can apply to ideal gas (volume expansion does not occur when the gas is heated),:  

Boyle's law at constant T, P = 1 / V  Charles's law, at constant P, V = T  Avogadro's law, at constant P and T, V = n  

So that the three laws can be combined into a single gas equation, the ideal gas equation  

In general, the gas equation can be written  

[tex]\large {\boxed {\bold {PV = nRT}}}[/tex]

where  

P = pressure, atm  

V = volume, liter  

n = number of moles  

R = gas constant = 0.08206 L.atm / mol K  

T = temperature, Kelvin  

To choose the formula used, we refer to the data provided

Because the data provided are temperature, pressure, volume and moles, than we use the formula PV = nRT

Purple box

T= 10 +273.15 = 373.15 K

V=5.5 L

n=2 mol

[tex]\tt P=\dfrac{nRT}{V}\\\\P=\dfrac{2\times 0.08205\times 373.15}{5.5}\\\\P=11.133~atm[/tex]

Yellow box

V=8.3 L

P=1.8 atm

n=5 mol

[tex]\tt T=\dfrac{PV}{nR}\\\\T=\dfrac{1.8\times 8.3}{5\times 0.08205}\\\\T=36.42~K=-236.733^oC[/tex]

Red box

T = 12 + 273.15 = 285.15 K

V=3.4 L

P=1.2 atm

[tex]\tt n=\dfrac{PV}{RT}\\\\n=\dfrac{1.2\times 3.4}{0.08205\times 285.15}\\\\n=0.174~mol[/tex]

True or False: An equation is balanced by changing subscripts as needed
True
False

Answers

Answer: False

Explanation:

If an electron is transferred from A to B in the chemical reaction shown here,
what molecule has been reduced?
AB
A+
A
B

Answers

if an electron is passed from Ago B then Slides electrons which makes it electropositive i.e A+

According to the redox reactions , when an electron is transferred from A to B , B molecule has been reduced as it gains electrons.

What are redox reactions?

Redox reactions comprise of two parts a reduced part and an oxidized part, which occur simultaneously . The part which is reduced gain electrons and hence there is a increase in oxidation state of the species.

While, the part which is oxidized looses electrons and hence there is a decrease in oxidation state of the species.During redox reactions, there is no net change in the number of electrons . Electrons which are given off in oxidation are used up in reduction.

The ion or molecule which accepts electrons is called as oxidizing agent while the ion or molecule which donates electrons is called as a reducing agent.

Learn more about redox reactions,here:

https://brainly.com/question/13293425

#SPJ2

Animals and Animal-like Protists share some characteristics. Tell how the organisms in these groups are the same? Why do you think scientists have placed them in different groups

Answers

Answer/Explanation:

Animals are multicellular heterotrophic organisms, meaning they cannot generate their own food, they rely on external sources of nutrition.

Protists are any eukaryotic organism that cannot be classified as an animal, plant, or fungus. The grouping is more used for convenience than anything else.

Like animals, animal-like protists can move freely and are heterotrophic. However, unlike animals, they are usually unicellular, and much simpler than animals

What are the basis of making symbols????​

Answers

Answer:

1/ Using the first letter of the name of the elements.

2/  If the name of two or more elements begins with the same letter,the second letter of their name is also taken with first letter.

3/ Symbols are made by using the letters of the name of elements in other languages also.

10. An atom that has 13 protons and 13 electrons is a neutral aluminum (Al) atom. An atom that has 13 protons and 10 electrons is a-​

Answers

Answer:

An atom of Al which has 13 protons and 10 electrons is Al cation (Al⁺³)

Explanation:

An atom consist of electron, protons and neutrons. Protons and neutrons are present with in nucleus while the electrons are present out side the nucleus.

All these three subatomic particles construct an atom. A neutral atom have equal number of proton and electron. In other words we can say that negative and positive charges are equal in magnitude and cancel the each other.

For example,

Al atom has 13 protons and 13 electrons. The number of positive and negative charge is equal thus it will be neutral atom.

While the atom of Al which have 13 proton and 10 electron is not neutral. The positive charge is greater than negative by 3. Which means 3 electrons are lose by Al atom and form cation "Al⁺³".

Thus an atom of Al which has 13 protons and 10 electrons is Al cation (Al⁺³)

Answer:

19

Explanation:

Other Questions
A primary care physician is a doctor who treats many types of illness and injuries. A specialist is a medical professional who has chosen to focus on one field of medicine, such as an oncologist, who treats only cancer, or a podiatrist, who focuses only on treating foot conditions. What are the advantages of seeing a specialist as opposed to a primary care physician? List at least one circumstance in which you might want to see a specialist, and at least one circumstance in which you might want to see a primary care physician. About 238,000 results (1.16 seconds) "as" (and any subsequent words) was ignored because we limit queries to 32 words. What is the difference between 9 and -2?711-7-11 Write the ratio in simplest form.12:18please help meeee ! !!HELP!! A coral reef, like the one shown in the photo, is a structure composed of the calcium carbonate exoskeletons of corals, a type of animal. Which term best characterizes the role of corals in a coral reef ecosystem? On the periodic table, why are all noble gases placed in column 18 (8A)?A.Noble gas elements have identical molar masses.B.Noble gases are all rarer than elements in other columns.C.The noble gases only chemically react with other noble gases.D.The valence electron configuration is similar in all noble gas elements. The model represents an equation.What value of x makes the equation true? HELP ASAP WILL MARK BRAINLY BRAINLIEST What stage of cellular respiration uses the high-energy electrons from NADH and FADH2 to form ATP molecules? Krebs cycle Electron transport chain Fermentation Glycolysis 3.Where do you fall in the "life isn't fair, deal with it" debate? Is this a good or bad way ofthinking about your life? Explain your answer. How are the barber and Captain Torres alike? *they both do their jobs extremely wellthey both do their jobs honorablyboth options are correctO neither option is correctWhich answer is correct Solve the following and explain your steps. Leave your answer in base-exponent form. (3^-2*4^-5*5^0)^-3*(4^-4/3^3)*3^3 please step by step!!!! Which option is considered a part of the document that is used to collect specific and predefined information?O text boxO WordArtO SmartArtO form 4. Root cells of plants take in some minerals from the surrounding soil by spendingenergy. After the plant obtains enough minerals to maintain health, the plant willcontinue to absorb minerals from the soil. Which reason best explains why root cellsneed to spend energy in order to transport some minerals into cells? According to this opinion, what does the Supreme Court believe?A minors age does not need to be taken into account when determining if he is in police custody.A minors age must be taken into account when determining if he is in police custody.All accused must be treated equally.J.D.B. was innocent of the crimes to which he confessed. if you ride your bike around the block, returning to the exact point where you started, your displacement is _____m?help please In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop ) essay on my future ambition as a teacher After conquering China, the Mongols created theHan Dynasty.Ming Dynasty.Song Dynasty.Yuan Dynasty. P5.30 Having a secure password is a very important practice, when much of our information is stored online. Write a program that validates a new password, following these rules: The password must be at least 8 characters long. The password must have at least one uppercase and one lowercase letter. The password must have at least one digit. Write a program that asks for a password, then asks again to confirm it. If the passwords dont match or the rules are not fulfilled, prompt again. Your program should include a function that checks whether a password is valid.