an interger that is less than -2 and greater than -3.5

Answers

Answer 1

Answer:

Literslly anything less then -2 and greater then -3.5

Step-by-step explanation:

-2.1

-2.2

-2.3

-2.4

-2.5

-2.6

-2.7

-2.8

-2.9

-3.0

-3.1

-3.2

-3.3

-3.4


Related Questions

Circle YES or NO The terms -5x and 5x are like terms.

Answers

Answer:

Step-by-step explanation:

Yes, they are. The like term is the variable x. The combine to form 0

Estimate 65 to the nesrst tenth then locate 65 on a number line​

Answers

Estimate 65 to the nearest tenth is 70 I can’t identify where 70 is on a number line for you but it is on the right side of the line

So the answer is 70

And look on the right side of the number line

Answer:

70

Step-by-step explanation:

ok so first of all you have to see if the next number is 5 you can borrow and then draw on number line between 65 and 70 that there is your answer 70

PLEASE HELP ITS DUE TODAYYY

Answers

Answer:

(-3,10) (0,5) (3,0) (6,-5)

Step-by-step explanation:

x intercept = 3

y intercept =5

If brainiest is earned its greatly appreciated

Write 2 x 10^3 in standard notation.

Answers

Answer:

2000

Hope this helps :)

Step-by-step explanation:

Since the exponent of the scientific notation is positive, move the decimal point 3 places to the right.

The standard notation of the expression is 2 x 10³ is 2000.

What is an expression?

An expression contains one or more terms with addition, subtraction, multiplication, and division.

We always combine the like terms in an expression when we simplify.

We also keep all the like terms on one side of the expression if we are dealing with two sides of an expression.

Example:

1 + 3x + 4y = 7 is an expression.

3 + 4 is an expression.

2 x 4 + 6 x 7 – 9 is an expression.

33 + 77 – 88 is an expression.

We have,

2 x 10³

Standard notation means writing an expression without any base and exponents.

Now,

10³ can be written as 1000.

So,

2 x 10³

= 2 x 1000

= 2000

Thus,

The standard notation is 2000.

Learn more about expressions here:

https://brainly.com/question/3118662

#SPJ2

Please help and please pick between a b c or d

Answers

The answer is A because the x^2 would be 4. 4x4=16

4. There are 37 students in the class.
Each student sold 41 boxes of nuts
About how many were sold?
(A) 1000
(B
1600
(C) 2000
DI 2400​

Answers

Answer:

B)1600

Step-by-step explanation:

Answer:

2000

Step-by-step explanation:

41 × 37 = 1517

Approximate 1517

Evquivilent Ratio for 23:37

Answers

Answer:

46:74

Step-by-step explanation:

Which expression is equivalent to 42 + 49?

Answers

Answer:

91?

Step-by-step explanation:

You don't have any pictures attached or anything so I don't get a full understanding of what you are trying to say, anyways Have a good day! :)

You have discovered another alien.
What is the equation of the line that provides the
correct path to rescue this alien?
y = 5
y = x + 5
y = -x + 5
y = 5x

Answers

Answer is : y= -x + 5

Answer:

y=-x+5

Step-by-step explanation:

have a great day :))))

A______ is a value, usually in the form of a letter or symbol, that can change or that represents an unknown quantity.

Answers

Answer:

Variable

Step-by-step explanation:

HURRY HURRY (function)

Answers

Answer:

h

Step-by-step explanation:

Answer these below
a) 3 ⋅ 1/3 =
b) 10 ⋅ 1/10 =
c) 19⋅ 1/19 =

Answers

Answer:

a) 3/3=1

b) 10/10=1

c) 19/19=1

Step-by-step explanation:

yes

Answer:

a) 1

b) 1

c) 1

Step-by-step explanation:

3 x 1/3 =

First we should understand that 3 in fraction form is 3/1.

(3 divided by 1 is three)

So we can rewrite this as;

3/1 x 1/3 =

Now just multiply across

3/1 x 1/3 = 3/3 = 1

Repeating this same logic we'll come across the following answers

10 x 1/10 = 10/10 = 1

19 x 1/19 = 19/19 = 1

Hope this helps

Pleas help I give brainliest ! Jejsjsjsjssjsjs

Answers

The chosen answer is correct. Only the 8n is raised to the 4th power, not the number 2, so the 8n is multiplied four times

how can I solve this equation

49x^2 - 14x + 1 <= 0​

Answers

x= 1/7 or x= 7^-1

(adding for limit)

Step-by-step explanation:

(7x)^2 - 2×7x×1 +1^2 =0

(7x-1)^2 =0

7x-1=0

7x=1

x= 1\7

What is the product?
-4.2.(-9)
O –72
0 -11
O 72
0 144

Answers

I’m assuming the question is asking what -4*2*-9 equals. If so it’s 72

21-28 please geometry

Answers

9514 1404 393

Answer:

  21–24 and 28 are correctly marked

  25: NEI; 26: ASA or LA; 27: SSS

Step-by-step explanation:

25: At least one side is required for showing congruence. In figure 25, only angles are shown congruent, so there is not enough information.

__

26: Two angles and the side between them are marked congruent. These triangles can be declared congruent by ASA. Considering they are right triangles, one could also invoke LA as the appropriate theorem.

__

27: The unmarked sides of the two outside triangles can be shown to be congruent by virtue of the fact they are opposite congruent angles in the middle triangle. Hence all three sides can be shown congruent for those outside triangles, and the SSS postulate can be invoked.

The function T(d)=10d + 20 gives the temperature in deegrees celcius inside the earth as a function if d, the depth in kilometers ,Find the temperature at.​

Answers

Answer:

Step-by-step explanation:

The question is incomoplete. Here is the complete question.

The function T(d)=10d + 20 gives the temperature in deegrees celcius inside the earth as a function if d, the depth in kilometers ,Find the temperature at 5km, 20km and 100km

T(d)=10d + 20

T(5)=10(5) + 20

T(5)=  50+ 20

T(5) = 70

Hence the temperature is 70 when d = 5km

when d = 20km

T(20)=10(20) + 20

T(20)=  200+ 20

T(20) = 220

Hence the temperature is 220 when d = 20km

when T = 100km

T(100)=10(100) + 20

T(100)=  1000+ 20

T(100) = 1020

Hence the temperature is 1020 when d = 100km

The temperatures at 5km, 20km and 100km are; 70°C, 220°C, and 1020°C respectively.

The complete question requires that we find the temperature at 5km, 20km and 100km.

The temperature function is; T(d)=10d + 20

For 5km;

T(5)=10(5) + 20

T(5) = 70°C

For 20km;

T(20) = 10(20) + 20

T(20) = 220°C

For 100km;

T(100)=10(100) + 20

T(100) = 1020°C

Read more;

https://brainly.com/question/15308045

At a local festival, general admission was $3 for students and $5 for adults. 331 people came to the festival and they sold a total of $1431 tickets. How many students came to the festival?

Answers

Answer:112

Step-by-step explanation:

I did it and we doing the same test rn haha. What did you get for the grant one?

PLZ ANSWER FASTTTTT (70 POINTSSSS)

Your parents deposited $1,500 into a new college fund that will earn an annual compound interest rate of 3%. How much money will be in the account when you need it for college in 5 years? (write and use the compound interest formula)

THANK YOU!!

Answers

Answer:

$1738.91

Step-by-step explanation:

Given

Deposit: P = $1500Interest rate: r = 3% = 0.03 compoundedTime: t = 5 yearsCompound number: n =1 per yearFinal amount A= ?

Formula for compound interest is:

A = P(1 + r/n)^nt

Substituting values

A = 1500(1 + 0.03/1)^1*5 =1500(1.03^5) = $1738.91

Peter has a part time job in factory and he can work 6 1/2 hours a day while his friend Joseph can work 1 2/3 hours more than Peter.how many hours can Joseph work more than Peter?

Answers

Given parameters:

Number of hours worked by Peter = 6.5hrs

Unknown:

Number of hours Joseph can work more than Peter =?

This problem is straight forward, the statement "his friend Joseph can work 1[tex]\frac{2}{3}[/tex]

is the solution to the problem.

Joseph can work 1[tex]\frac{2}{3}[/tex] more than Peter.

Overall, Joseph can work;

                  6.5hrs + 1[tex]\frac{2}{3}[/tex]hr   = 8.2hrs

Three times a number decreased by 5 equals 10. Write the equation and find the number.

Answers

Answer:

3x - 5 = 10

Step-by-step explanation:

Duke Energy reported that the cost of electricity for an efficient home in a particular neighborhood of Cincinnati, Ohio was $104 per month (Home Energy Report, Duke Energy, March, 2012). A researcher believes that the cost of electricity for a comparable neighborhood in Chicago, Illinois is higher. A sample of homes in this Chicago neighborhood will be taken and the sample mean monthly cost of electricity will be used to test the following null and alternative hypotheses.
Assume the sample data lead to rejection of the null hypothesis.
What would be your conclusion about the cost of electricity in the Chicago neighborhood?
The input in the box below will not be graded, but may be reviewed and considered by your instructor. What is the Type I error in this situation?
The Type 1 error in this situation What are the consequences of making this error?
The input in the box below will not be graded, but may be reviewed and considered by your instructor. What is the Type II error in this situation?

Answers

Answer:

When the null hypothesis is rejected

The  conclusion is that there is enough evidence to support the claim of the researcher

When a type I error occurs

The consequences is that the conclusion that there is enough evidence to support the claim of the researcher is actually incorrect

When a type II error occurs  

 The consequences is  that the conclusion that there is enough evidence  to support the claim of the researcher is actually correct        

Step-by-step explanation:

From the question we are told that

The cost of electricity per month is [tex]\mu = \$104[/tex]

The null hypothesis is [tex]H_o : \mu = \$104[/tex]

The  alternative hypothesis is   [tex]H_o :  \mu  >   \$104[/tex]

Generally if the null hypothesis is rejected then the conclusion would be that there is enough evidence to support the claim of the researcher

Generally a Type I error is a an error that occurs when the null hypothesis is incorrectly rejected

So in the case of this question the consequence of making this type of error is that the conclusion that there is enough evidence to support the claim of the researcher is actually incorrect

 Generally a Type II  error is an error that occurs when the null hypothesis is incorrectly not rejected

So in the case of this question the consequence of making this type of  

error is that the conclusion that there is enough evidence to support the claim of the researcher is actually correct

-7 w2 + 2w. (If w = -4)​

Answers

photo math vtvyvunif tcybubuhi

HELP NEEDED ASAP. "ONLY ANSWER IF YOU KNOW THE ANSWER"
Solve the equation by completing the square.
x^2 + 10x= -81

Answers

Answer:

x =-5±  2i sqrt(14)

Step-by-step explanation:

x^2 + 10x= -81

Take the coefficient of x and divide by 2

10/2 = 5

Square it

5^2 =25

add to each side

x^2 + 10x+25 = -81+25

( x+5) ^2 = -56

Take the square root of each side

sqrt(( x+5) ^2) =± sqrt(-56)

x+5 = ± sqrt(-1) sqrt(4*14)

x+5 =± i sqrt(4)sqrt(14)

x+5 =± i 2 sqrt(14)

Subtract 5 from each side

x+5-5 =-5± i 2 sqrt(14)

x =-5±  2i sqrt(14)

One minute is 1/60 of an hour. What part of an hour is 12 minutes?

Answers

2/10ths of an hour. You do 12/60 and get 0.2

Answer:

12/60 but you want the simplified which is 1/5 or 20%

A green grocer has 180 mangoes to sell. She has to arrange them in piles of 9, 10 or 12mangoes.
In which ways would she arrange the mangoes without any remaining?​

Answers

Answer:

in piles of 9,10 &12

Step-by-step explanation:

this is because if you divide 180 by each number there is no remainder hence the green grocer can arrange in any way.

It is possible to arrange the total of mangoes by using 20 piles of 9 mangoes, 18 piles of 10 mangoes, or 15 piles of 12 mangoes.

What is division?

Division is the process of splitting a number or an amount into equal parts. Division is one of the four basic operations of arithmetic, the ways that numbers are combined to make new numbers. The other operations are addition, subtraction, and multiplication.

The conditions for mangoes to be arranged are that the piles should have either 9, 10 or 12 mangoes and reminders are not allowed. This means you need to fit all the mangoes and no mangoes can be left.

Based on the conditions and the total number of mangoes (180 mangoes), here are the possibilities that you can determine using division:

9 mangoes piles: 180/ 9 = 20 piles (9 x 20 = 180 with no remainders)

10 mangoes piles: 180/10 = 18 piles (10 x 18 = 180 with no remainders)

12 mangoes piles: 180/12 = 15 piles (12 x 15 = 180 with no remainders)

Hence, It is possible to arrange the total of mangoes by using 20 piles of 9 mangoes, 18 piles of 10 mangoes, or 15 piles of 12 mangoes.

Learn more about division in

brainly.com/question/369266

#SPJ2

Find all zeroes of the function. Enter the real zeroes separated by commas.

Answers

Answer:

f(x)

=(x-4)[6(x^2)+23x+20]

=(x-4)(2x+5)(3x+4)

x=4,-2/5,-3/4

In a survey of 600 students 80 percent said they liked pop music.How many students liked pop music

Answers

Answer:

600 × .8 = 480

480 Students

How do i do this problem

Answers

Answer:

no clue

Step-by-step explanation:

Divide the numerator to the denominator 6-737

Suppose that y varies directly with x, and y=3 when x=15

Find y when x=10

Answers

Answer:

yaa , when X=15, y = 3;

here the value of X is five times the value of y

so when X= 10

then. y =X/5 = 10/5= 2

so the value of y will be 2

hope you like the answer

Other Questions
BRAINLIEST What stage of cellular respiration uses the high-energy electrons from NADH and FADH2 to form ATP molecules? Krebs cycle Electron transport chain Fermentation Glycolysis 3.Where do you fall in the "life isn't fair, deal with it" debate? Is this a good or bad way ofthinking about your life? Explain your answer. How are the barber and Captain Torres alike? *they both do their jobs extremely wellthey both do their jobs honorablyboth options are correctO neither option is correctWhich answer is correct Solve the following and explain your steps. Leave your answer in base-exponent form. (3^-2*4^-5*5^0)^-3*(4^-4/3^3)*3^3 please step by step!!!! Which option is considered a part of the document that is used to collect specific and predefined information?O text boxO WordArtO SmartArtO form 4. Root cells of plants take in some minerals from the surrounding soil by spendingenergy. After the plant obtains enough minerals to maintain health, the plant willcontinue to absorb minerals from the soil. Which reason best explains why root cellsneed to spend energy in order to transport some minerals into cells? According to this opinion, what does the Supreme Court believe?A minors age does not need to be taken into account when determining if he is in police custody.A minors age must be taken into account when determining if he is in police custody.All accused must be treated equally.J.D.B. was innocent of the crimes to which he confessed. if you ride your bike around the block, returning to the exact point where you started, your displacement is _____m?help please In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop ) essay on my future ambition as a teacher After conquering China, the Mongols created theHan Dynasty.Ming Dynasty.Song Dynasty.Yuan Dynasty. P5.30 Having a secure password is a very important practice, when much of our information is stored online. Write a program that validates a new password, following these rules: The password must be at least 8 characters long. The password must have at least one uppercase and one lowercase letter. The password must have at least one digit. Write a program that asks for a password, then asks again to confirm it. If the passwords dont match or the rules are not fulfilled, prompt again. Your program should include a function that checks whether a password is valid. The concentration of the solute in the solution is the same as in the cell the rational number 9.8 is the best approximation to the tenth of which irrational number?89 squared92 squared96 squared98 squared Which of the following reasons led the Texans to revolt against the Mexican government? A. A tax on cotton? B. Outlawing Slavery? C. Annexation of California? or D. Forcing Texans off their land? Why did slavery come to a halt in the 1750s? i need help with this too please A random telephone survey of 1021 adults (aged 18 and older) was conducted by Opinion Research Corporation on behalf of CompleteTax, an online tax preparation and e-filing service. The survey results showed that 684 of those surveyed planned to file their taxes electronically.a. Develop a descriptive statistic that can be used to estimate the percentage of all taxpayers who file electronically.b. The survey reported that the most frequently used method for preparing the tax return was to hire an accountant or professional tax preparer. If 60% of the people surveyed had their tax return prepared this way, how many people used an accountant or profes-sional tax preparer what did the two world wars change?