A telephone pole has a wire attached to its top that is anchored to the ground. The distance from the bottom of the pole to the anchor point is 23 feet less than the height of the pole. If the wire is to be 9 feet longer than the height of the pole, what is the height of the pole?

Answers

Answer 1

9514 1404 393

Answer:

  56 feet

Step-by-step explanation:

Let x represent the height of the pole. Then the distance to the anchor point is (x-23), and the length of the wire is (x+9). The Pythagorean theorem tells you the relation between these values is ...

  (x+9)² = x² +(x -23)²

  0 = x² -64x +448 . . . . . subtract the left side, put in standard form

  0 = (x -8)(x -56) . . . . . . factor

The solutions to the quadratic are x=8 and x=56. For our purposes, we require x > 23 so the distances are positive. That means x=56 is the solution of interest.

The pole is 56 feet tall.


Related Questions

Chuck put new wallpaper in his bathroom. The pattern of the wallpaper
used 3 triangles to make a straight angle. The measures of the angles
are (9x - 72). (73x + ) and 11) What is the measure of the
obtuse angle? 7.3.5
ext
Tota

Answers

Answer:

x = 2.93

Step-by-step explanation:

The sum of angles of the triangle is 180degrees, hence;

9x - 72 + 73x + 11 = 180

82x - 61 = 180

82x = 180 + 61

82x  = 241

Divide both sides by 82

82x/82 = 241/82

x = 2.93

Note that the functions might not be accurate but the same methos should be employed for any function given

Tinley is training to run a half-marathon. She sets a pace so that every mile takes
7 minutes.

Write an equation for the amount of time,
t, it takes Tinley to run
m miles.

Answers

Answer:

t=7m

Step-by-step explanation:

In this equation, "t" represents time, and "m" represents miles. Each mile is 7 minutes. To find how much time this run will take her, multiple the amount of miles she will run by 7.

For example:

If Tinley runs 13 miles you should do-

7(13)= 91

13 miles would take Tinley 91 minutes

Find the missing number if the following
subtraction is in base six
4 5 2
* * *
254

Answers

356 is the missing number

x = 5 what is 6x equal

Answers

Answer:

6 x 5= 30

Step-by-step explanation:

6(5)=30

find equation of the line that contains the point (4,-2) and is perpendicular to the line y= _2x+8

Answers

Answer:

y = 1/2x - 4

Step-by-step explanation:

If two lines are perpendicular to each other, they have opposite slopes.

The first line is y = -2x + 8. Its slope is -2. A line perpendicular to this one will  have a slope of 1/2.

Plug this value (1/2) into your standard point-slope equation of y = mx + b.

y = 1/2x + b

To find b, we want to plug in a value that we know is on this line: in this case, it is (4, -2). Plug in the x and y values into the x and y of the standard equation.

-2 = 1/2(4) + b

To find b, multiply the slope and the input of x (4)

-2 = 2 + b

Now, subtract 2 from both sides to isolate b.

-4 = b

Plug this into your standard equation.

y = 1/2x - 4

This equation is perpendicular to your given equation (y = -2x + 8) and contains point (4, -2)

Hope this helps!

9514 1404 393

Answer:

  y = 1/2x -4

Step-by-step explanation:

We presume the given line is ...

  y = -2x +8

This is in slope-intercept form, which allows us to determine easily that the slope of this line is -2.

A perpendicular line will have a slope that is the opposite reciprocal of -2:

  m = -1/(-2) = 1/2

The y-intercept of the desired line can be found from the point (x, y) = (4, -2) using the equation ...

  b = y - mx

  b = -2 -(1/2)(4) = -4

Now, we know the slope and y-intercept of the desired perpendicular line through (4, -2), so we can write its equation as ...

  y = 1/2x -4

__

Additional comment

"Slope-intercept form" is ...

  y = mx + b . . . . . . where m is the slope and b is the y-intercept

In 1980 more than 35% of cars purchased had a manual transmission (i.e. stick shift). By 2007 the proportion had decreased to 7.7%. A random sample of college students who owned cars revealed the following: out of 133 cars, 31 had stick shifts. Estimate the proportion of college students who drive sticks with 90% confidence. Use a graphing calculator and round the answers to at least three decimal places. <

Answers

Answer:

The 90% confidence interval for the proportion of college students who drive sticks is (0.173, 0.293).

Step-by-step explanation:

In a sample with a number n of people surveyed with a probability of a success of [tex]\pi[/tex], and a confidence level of [tex]1-\alpha[/tex], we have the following confidence interval of proportions.

[tex]\pi \pm z\sqrt{\frac{\pi(1-\pi)}{n}}[/tex]

In which

z is the zscore that has a pvalue of [tex]1 - \frac{\alpha}{2}[/tex].

A random sample of college students who owned cars revealed the following: out of 133 cars, 31 had stick shifts.

This means that [tex]n = 133, \pi = \frac{31}{133} = 0.233[/tex]

90% confidence level

So [tex]\alpha = 0.1[/tex], z is the value of Z that has a pvalue of [tex]1 - \frac{0.1}{2} = 0.95[/tex], so [tex]Z = 1.645[/tex].

The lower limit of this interval is:

[tex]\pi - z\sqrt{\frac{\pi(1-\pi)}{n}} = 0.233 - 1.645\sqrt{\frac{0.233*0.767}{133}} = 0.173[/tex]

The upper limit of this interval is:

[tex]\pi + z\sqrt{\frac{\pi(1-\pi)}{n}} = 0.233 + 1.645\sqrt{\frac{0.233*0.767}{133}} = 0.293[/tex]

The 90% confidence interval for the proportion of college students who drive sticks is (0.173, 0.293).

A teacher has 1/4 gallon or mlik

Answers

Answer:

notify me when you finish the question so i can answer ok

Step-by-step explanation:

Answer:

This means that there is 3/4 gallon or quarts left of milk that the teacher has.

Step-by-step explanation:

Tomato juice is sold in a case with 8 cans. Complete the table to show the relationship between the number of cases and the number of cans .

Answers

Step-by-step explanation:

1 case- 8 cans

If you have 32 cans and you know that 1 case can have 8 cans you do this:

32:8=4 cases

Then if you have 10 cases in each you get 8 cans so it equals:

10*8=80cans

And last:

You have 96 cans and again you know that one case can contain 8 cans so it is:

96:8=12 cases

When you write that:

1. answer: 8

2.answer:4

3.answer:80

4.answer:12

4. Dominick sent the following number of text messages each day over the last week:
SUN
MON
TUES
WED
THURS
FRI
SAT
64
58
63
51
60
61
70
What is the mean absolute deviation?
Explain what the mean absolute deviation represents in the situation:

Answers

add all of the numbers and divide by the amount of numbers added

An amusement park has 16 attractions, including 6 rides.

What is the probability that a randomly selected attraction at this amusement park will be a ride?

Answers

The probability it will be a ride = total number of rides / total attractions.

Probability = 6/16

Probability = 3/8

Answer:

Solution :-

Probability is defined as the favourable outcomes divided by total outcomes

Probability = Favourable Outcome/Total outcomes

Probability = 6/16

Probability = 3/8

[tex] \\ [/tex]

NO LINKS

Mark wants to put a circular pool in his backyard. The pool has an area of 379.94 square feet. If his backyard is 10 x 15 feet, will the pool fit? Use 3.14 for pi

Answers

Answer:

no, the backyard is only 150 square ft. so a pool with an area of 379.94 square ft will not fit

Step-by-step explanation:

10×15=150

Paula runs a stable. 20 horses currently board at the stable, and 8 of them are bay.

What is the probability that a randomly chosen horse will be bay?

Write your answer as a fraction or whole number.
p ( bay ) = ?

Answers

Answer:

40% chance

Step-by-step explanation:

Take the number of horses total and divide the number of bay horses.

Question 5 (1 point)
Solve the inequality for x.
- 3x + 6 < 15
Ox>-3
Ox<-3
0x<-7
Ox>-7

Answers

Answer:

x > -3

Step-by-step explanation:

-3x + 6 < 15

-3x < 15 - 6

-3x < 9

-x < 3

x > -3

A. x > -3

Step-by-step explanation:

Step 1: Subtract 6 from both sides.

−3x + 6 − 6 < 15 − 6

−3x < 9

Step 2: Divide both sides by -3.

−3x/−3 < 9/−3

x > −3

Please help ! Please help! I will heart you !

Answers

Answer:

x = 65

Step-by-step explanation:

x + 115 = 180

x = 65

Answer:

65 degrees

Step-by-step explanation:

180-115=65 degrees

The line that 115 degrees is on is equal to 180.

how many squre deet of outdoor carpet will we need 11ft 3ft 2ft 3 ft​

Answers

Answer:

39 sq feet

Step-by-step explanation:

-6(2p + 1) = -7p - 31

Answers

Answer:

P=5

Step-by-step explanation:

-6(2p + 1) = -7p - 31

Expand -6(2p+1)

Apply distributive law;

a=-6, b=2p, c=1

=-6*2p+(-6)*1

=-6*2p-6*1

Simplify; -6*2p-6*1

=-12p-6

-12p-6=-7p-31

Add 6 to both sides;

-12p-6+6=-7p-31+6

simplify;

-12p=-7p-25

Add 7p to both sides;

-12p+7p=-7p-25+7p

Simplify;

-5p=-25

Divide both sides by -5

-5p/-5=-25/-5

Simplify:

p=5

Answered by the One and Only #DrippQueenMo

Answer:

p=5

Step-by-step explanation:

first you want to get rid of the parentheses in -6(2p+1) so take -6 and times it by 2p and 1 to get -12p-6. You can do this because of the distributive property. Now you have the equation -12p - 6 = -7p - 31. So now you want to get the p values on one side. Adding 7p to both sides of the equations get rid of the -7p. -12p + 7p equals -5p so now you have the equation -5p - 6 = -31. so now you need to get the whole numbers on one side. So add 6 to both sides so you can get rid of the -6. this leaves you with the equation -5p= -25. Now to find the value of p you divide both sides by -5. This gives you p = 5.

A certain brand of all-purpose plant food is sprinkled evenly over the soil surface at a rate of 4.8 ounces per 10
square feet. What is the unit rate of ounces per square feet?
A)0.48
B)21
C)48
D) 2.08

Answers

Answer:

48(c)

Step-by-step explanation:

4.8=48 as move 10 will change 4.8 as 48


A map of an island is shown on a half-centimetre grid,
where A, B and Care houses.
The actual distance between A and B
is 960 metres.
a) Work out the scale on the map.
A
Give your answer in the form 1:n
+
(2)
b) Work out the actual distance
between A and C in kilometres.
Your final line must say, AC = ... km
c
(4)
Total marks: 6

Answers

Answer:

The answer is b.

Step-by-step explanation:

Answer:

a) 1:48000 b)1.6128km

Step-by-step explanation:

Identify the relationship of each angle pairs. Choose your answer from the choices given.

Answers

Answer:

scheu7rggi6rewhjvzdeguij

I need an Answer not a link.

Answers

Answer:     C

Step-by-step explanation:

Plz tell me if i am wrong

22 percent because it’s the highest percent

WILL GIBE BRAINLIEST ASAP

Answers

Answer:

A and D have whole grid squares that are the same size and aren't over lapping

C has overlapping grid squares making it hard to count

B can't be used to find area because some of the grid squares are different sizes

You still could use B because four of the smaller squares seems to be equivalent to one of the larger squares

Step-by-step explanation:

Answer:

the guy up there is right

Step-by-step explanation:

plz help will give crown

Answers

Answer:

C

Step-by-step explanation:

Can I have crown

Workout the probability that spinner A lands on 2 and spinner b does not land on b

Answers

Spinner diagram isn't attached. A related spinner diagram has been attached below to provide an hypothetical solution to the problem

Answer:

4 / 15

Step-by-step explanation:

For the numbered spinner :

P(landing on 2) = required outcome / Total possible outcomes

Total possible outcomes = (1, 2, 3) = 3

Required outcome = (1) = 1

P(landing on 2) = 1 /3

Lettered spinner :

P(does not land on b)

Total possible outcomes = (A, B, C, D, E)

Required outcome = (a, c, d, e)

P(does not land on b) = 4 / 5

Hence,

P(lands on 2, does not land on b) in this scenario is :

1/3 * 4/5 = 4 / 15

Find the common difference of the arithmetic sequence -19, -16, -13, ...

Answers

Answer:

d= +3

Step-by-step explanation:

1st term = -19

2nd term = -16

d = 2nd - 1st

d= -16-(-19)

d = +3

Gross income: $408.68
Deductions: $98.98


Net income: $_

Answers

Answer: $507.66

Step-by-step explanation:

408.68 + 98.98 = 507.66

A rock with a mass of 25 g is added to a graduated cylinder containing 45 mL of water. The water level rises to the 50mL mark. Based on this information, what is the density of the rock?

Answers

Answer:

We know the density of water is 1 gm/ml

Mass of rock = 25 g

Volume of rock = 5 ml

So the density of the rock is       25 g / 5 ml = 5 gm / ml

Answer choices are
A.) x= 2 and x = -3
B.) x = 3 and x = 4
C.) -2 and x = -1
D.) -2 and x = 1

Answers

The answer is D.) x= -2 and x= 1

Question
The value of y varies directly as the cube of u and y = 54 when I = 3. Find the equation that represents this relationship.

Answers

Answer:

2x^3

Step-by-step explanation:

The equation that represents this relationship will be y = 2u³.

What are ratio and proportion?

A ratio is a collection of ordered integers a and b represented as a/b, with b never equaling zero. A proportionate expression is one in which two items are equal.

The value of y varies directly as the cube of u. y = 54 when u = 3.

y ∝ u³

Removed the proportionality constant and place the equal sign with constant k.

y = ku³

Put y = 54 when u = 3, then the value of k will be

54 = k (3)³

54 = 27k

k = 2

Then the equation that represents this relationship will be

y = 2u³

The equation that represents this relationship will be y = 2u³.

More about the ratio and the proportion link is given below.

https://brainly.com/question/14335762

#SPJ2


Explain the different ways you can name an angle. What are the different names for this angle?

Answers

Step-by-step explanation:

Hi,

This is an acute angle.

RST, STR, and TRS are the three different ways to represent/name this angle.

I hope this helps :)

<4and <5 are alternate interior angles. Find the measure of <5

Answers

Answer:

115 degrees

Step-by-step explanation:

Since <4and <5 are alternate interior angles, this means that they are equal because alternate interior angles of a geometry are equal. Hence since

<4 = 115 degrees, <5 is also equal to 115 degrees

Other Questions
Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY Which equation can be used to solve for x in the following diagram?150102 Marcys breakfast table has a square table top with an area of 36 square feet. What is the approximate diagonal length of the table top? Round to the nearest tenth. Figure out length in inches for brainiest and 5 stars. ZABD and ZDBC are supplementary angles.What is the measure of x?x = [?]7DAT110%B>CAngles are not drawn to scale.Enter The number of blueberry muffins made is 40% of the total number of total muffins they make daily. On tueday, the baker makes 60 muffins. How many miffins does the Baker bakes on Tuesday? easy algebra question below first correct answer gets brainliest, if you put one of those links you will get reported and blocked Which value of x makes the inequality -* < 8 true?AX = 32BX = 35x = 34D= 2 What turns the drive shaft of the generator?Help Sophie has a doll collection with 36 dolls. She decides to sell s dolls to a museum and has r dolls remaining.What is the independent variable? The diffusion of gas inside the lungs is dependent on two liquids: water and surfactant. Without the surfactant lining the inner surface of the alveoli, what would most likely happen? (2 points)Air would not reach the bronchioles.Air would be trapped in the bronchioles.The lungs would over inflate.The lungs would lack the pressure needed to inflate. 8 yd6 yd15 yd10 ydAnswer:please help!:) After George learned that Mrs. Min suffered from schizophrenia, he mistakenly concluded that her tendencies to laugh easily and smile frequently were symptoms of her disorder. This best illustrates the: unreliability of the DSM-V unreliability of the DSM-V shortcomings of the medical model shortcomings of the medical model biasing power of diagnostic labels biasing power of diagnostic labels dangers of the biopsychosocial approach dangers of the biopsychosocial approach Which adaptations suit a beaver?