A population of tree frogs living in the Amazon rainforest have two skin color phenotypes controlled by the same gene. Hozygous dominant and heterozygous individuals have green skin while hozygous recessive individuals have blue skin. In the first generation, analysis of the alleles for this gene shows that 70 alleles of this gene are green, and 130 alleles of this gene are blue in the population. In the second generation, 90 alleles are green and 110 alleles are blue. Finally, in the third generation, 120 alleles are green and only 80 are blue. Based on this data, which description best describes this population of tree frogs?(1 point)

A) The green skin color is being selected over blue skin color.

B) The frogs are randomly mating with each other.

C) The population size of frogs is very large.

D) There are no individuals migrating into or out of the population.

Answers

Answer 1

Answer:

A

Explanation: You can see that the green colored frogs  were once lower than the blue and as time started progressing the green started getting a higher population over the blue, as the blue decreased.

Answer 2

For the frogs, the green skin color is being selected over blue skin color. This leads to the abundance of the skin color in the third generation.

What is natural selection?

Natural selection refers to a situation in which traits that enable organisms to better survive and adapt in their habitat tend to persist whiole other traits gradually disappear.

In this case, we  can say that the green skin color is being selected over blue skin color.

Learn more about natural selection: https://brainly.com/question/3393755?


Related Questions

2. Which is an example of interspecific competition?

blue jays eating seeds from my bird feeder
white-tailed deer looking for food in a field
polar bears praying on seals in the artic ocean
squash outgrowing lettuce in my garden​

Answers

Inter specific competition occurs when two individuals compete for the same resources. Therefore the correct example would be the squash outgrowing the lettuce.

Base your answers to the following question on the structures represented in the diagram.

Review Packet- Modern Genetics Name___________________________ Page 1

What is the relationship between these three structures?

Group of answer choices

Protein is composed of DNA that is stored in the cell

The cell is composed only of DNA and protein

DNA is made up of proteins that are synthesized in the cell

DNA controls the production of protein in the cell

Answers

C. DNA controls the production of protein in the cell

Create some GREAT SCIENTIFIC game of hide and seek to play in class.

Answers

Answer:

you can place scientific terms around the classroom and the kids must work in groups to find the cards. Then you let the kids read the terms at the end.

Explanation:

The spinal cord is automatically arranged with

Answers

cervical region

spinal nerves

central canal

Central canal because of science

Some students correctly made a life cycle model for two specific animals. One group has made a model showing three parts, and another group has made a model showing four parts. Which parts would the group modeling incomplete metamorphosis have in their model?
A. egg, larva, adult
B. egg, nymph, adult
C. egg, larva, pupa, adult
D. egg, pupa, nymph, adult

Answers

C.

The life cycle of a mosquito goes eggs, larva, pupa, adult.

have a wonder day :)

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC
9. Which amino acids would be found in the mutation protein?
Which amino acids would be found in the mutation protein

Answers

Answer:

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

Explanation:

This question is describing the process of translation, which is the second stage of protein synthesis. Translation is the process whereby a mRNA template is used to produce amino acids, which forms a sequence that will eventually become protein.

The mRNA sequence is read in a group of three nucleotides called CODON. Each codon specifies a particular amino acid. According to this question, using the genetic code table, the given DNA sequence is as follows:

DNA: CAT- TGG- CTA- ACG- TCG- ATA- ATC- GTC- GGT- AC

RNA = GUA- ACC- GAU- UGC- AGC- UAU- UAG- CAG- CCA- UG

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

write any two uses of Rocks and Minerals of each?​

Answers

Answer:

The use of rocks and minerals includes  building material, cosmetics, cars, roads, and appliances.

Explanation:

Rocks and minerals are all around us! They help us to develop new technologies and are used in our everyday lives. Our use of rocks and minerals includes as building material, cosmetics, cars, roads, and appliances. In order maintain a healthy lifestyle and strengthen the body, humans need to consume minerals daily

Please help!!!
Which structure is smaller?
A. Chromosome
B. Histone
C. Nucleosome

Answers

Answer:

B. Histone because they are a family of small positively charged proteins.

DNA is normally found in the nucleus as
but condenses into
during cell division.
A. histones, chromosomes
B. chromosomes, chrothatin
C. chromatin, chromosomes

Answers

Answer:

The answer is chromatin and chromosomes.

i think the answer is c

14. Which nitrogenous base isn't found in DNA?

Answers

Answer:

Uracil is a nitrogenous base found in all RNA but not present in DNA.

Explanation:

plz mark brainliest

Answer:

Uracil

Explanation:

Uracil is a base found in RNA (but not in DNA) and derived from pyrimidine; pairs with adenine. Uracil the nitrogenous based is not found in DNA.

So, the final answer is Uracil.

Choose all the answers that apply.

Which of the following energy sources harms the
environment?

A.) coal
B.) hydroelectric power
C.) nuclear power
D.) oil

Answers

Answer:

c nuclear power because it destroy the places

Oil coal nuclear power

f(x) = −16x2 + 60x + 16

Answers

Answer:

x = − 0.25 , 4

x = − 1 /4 , 4

Explanation:

Which wire, when current flows through it, would be surrounded by the strongest magnetic field?

A thin copper colored bar.
A copper colored coil with 2 turns.
A copper colored coil with 5 turns.
A thick copper colored bar.
Mark this and return Save and Exit

Answers

Answer:

A copper with 5 turns

Explanation:

Answer:the other guy is right

Explanation:

One of the biggest sources of greenhouse gases released into the
atmosphere is emissions from burning fossil fuels. How could carbon
sequestration help alleviate problems associated with burning fossil fuels?
A. It could make fossil fuels a clean-burning energy resource.
B. It could prevent carbon dioxide from being a greenhouse gas.
O C. It could prevent released carbon dioxide from entering the
atmosphere.
D. It could make fossil fuels a renewable energy resource.

Answers

Answer:

The correct answer is - B. It could prevent carbon dioxide from being a greenhouse gas.

Explanation:

Carbon sequestration is the process that involves capturing and removal of atmospheric carbon dioxide from the atmosphere and prevent it from changing climate by increasing global warming as carbon dioxide gas traps the heat.

It is helping in the removal of excess carbon dioxide from the atmosphere and prevents it from being a greenhouse gas and increase global warming. It could be geological or biological.

Answer: C- it could prevent released carbon dioxide from entering the atmosphere

Explanation: ap3x

Some cells release active signaling proteins when membrane-bound precursor proteins are cleaved by proteolytic enzymes. The signaling proteins can then bind to receptors on the surface of a target cell, thereby activating an intracellular signaling pathway and eliciting a response from the target cell. This mechanism of activating receptor-binding signaling proteins has been observed in a variety of organisms from bacteria to humans. Many of the enzymes responsible for proteolysis of membrane-bound precursor proteins have been isolated and characterized.


Required:

What questions would be most appropriate to investigate whether the proteolytic enzymes are evolutionarily conserved among species?

Answers

Answer:

Following questions would be most appropriate to investigate whether the proteolytic enzymes are evolutionarily conserved among species:

Are the genes encoding the proteolytic enzymes expressed in the same cell types in all species?  Once the precursor proteins of different species are cleaved, do the active signaling proteins bind to  the same receptors on different target cells? If a proteolytic enzyme from one species is incubated with a precursor protein from another species, does correct cleavage occur? Are the proteolytic enzymes synthesized in the rough endoplasmic reticulum of all species?

Why human cell is consider as eukaryotic cell where as bacteria cell as prokaryotic cell?​

Answers

They do not have a nucleus or membrane organelles

I NEED HELP, can someone make do this real quick?

Answers

Answer:

The answer is A because abc


When can an acquired mutation be passed from parent to offspring

Answers

If the mutation takes place in a gamete that ends up forming an embryo, the mutation will be passed on to an offspring. This can also occur if the mutation occurs early in an embryos development, and the cell becomes one of the gamete forming cells, the mutation will be passed on to their offspring.

The __
__from farmland is often contaminated with pesticides, herbicides,
fertilizers, and oils used in farm equipment.
A. ammonia buildup
B. runoff
C. livestock
D. acid rain

Answers

Answer:

B. Runoff

Explanation:

The result of a magma plume rising and decompression melting occurring may
be the formation of a small volcanic region called a(n).

Answers

Hot spot: is the answer

Which of the following statements about lichens are true?

Answers

Answer:

The photobiont supplies the association organic carbon from photosynthesis, and the mycobiont ensures protection and regulates the supply of minerals and water. The nutritional exchange between partners is probably much more complex than exchange of water and minerals for organic carbon. Thus, the correct answer is option B.

Answer:juegan maincra

Explanation:porque si

1. Imagine you played the game, and the results are as follows. Examine the tables below and questions (a) and (b)
Sample Data for Stable Food Scenario for EAST SIDE (Wet).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 3 2 2
3 4 4 4
4 5 5 6
Sample Data for Stable Food Scenario for WEST SIDE (Dry).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 2 2 2
3 3 2 2
4 4 2 2
A) Describe what happens to the bird population for both the East and West sides of the Islands in terms of its composition of different size beaks when the food source is stable over several seasons.
B) Are the initial populations maintained, explain?
2. Imagine you played the game again, but under different conditions. Examine the tables below, and answers (a), (b), and (c).
Sample Data for Natural Selection Scenario for EAST SIDE (Wet).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 3 3 3
3 4 3 2
4 8 5 0
Sample Data for Natural Selection Scenario for WEST SIDE (Dry).
Season Large (AA) Medium (Aa) Small (aa)
1 2 2 2
2 2 2 2
3 2 2 2
4 2 0 3
A) What happened to the composition of the original population over these four seasons for the East and the West?
B) What factor(s) might have caused these changes?
C) How was natural selection acting on this population?

Answers

Answer:

The population is increase in the east due to good and wet environment.

Explanation:

The bird population of the East and west sides of the Islands is increases of different size beaks when the food source is stable over several seasons because the presence of food to all size of beaks leads to increase in their populations. The initial populations is increased in the east side as compared to west side may due to good environmental conditions. The population of east side increases as compared to west side due to good and favourable environmental condition of the east side of the island.

Ps. Answer is B William meets Kate They both share many of the same beliefs and interests. Based on the effects of similarity on
attraction, which of the following is most likely to be William's reaction?
A William will be more likely to trust Kate than he would a stranger
B. William will be more attracted to Kate than he would a stranger.
C. William will be more likely to love Kate than he would a stranger
D. William will be more likely to distrust Kate than he would a stranger
Please select the best answer from the choices provided
A

Answers

Answer:

William will be more attracted to Kate than he would a stranger.

Explanation:

Option B is your answer choice. Have a great day ☺

On the effects of similarity on attraction, the following is most likely to be William's reaction,  William will be more attracted to Kate than he would a stranger. Thus, option "B" is correct.

How they both share many of the same beliefs and interests?

Research has found people tend to feel attracted to those who are similar to them, which is probably an evolved preference.

Still, there are several explanations for this liking. Psychologist says we believe people who are similar to us will be more likely to like us. Another reason would be that shared experiences and values make us feel more certain and positive in the world. Whatever reason it may be, the truth it psychology sees such tendency as deeply rooted in the human psyche.

Thus, option "B" is correct.

To learn more about psychology click here:

https://brainly.com/question/10980588

#SPJ2

1. Geologists use physical properties to identify minerals. For example, the blank

cleavage, color, fracture, hardness, luster, specific, gravity, streak, texture

Answers

Answer:

The correct answer is - crystal form (external shape).

Explanation:

Physical properties are used for the identification of the minerals that include specific gravity, streak, texture, luster color, hardness, cleavage, and crystal form.

The most common physical property of the minerals in crystal form or external shape of the mineral. This is the property of the mineral that gives an idea about the homogenous possessing a 3-D internal order.

Answer:

crystal form external shape

Explanation:

i copied lol

Decide if the following statements best describe map-based genome sequencing, best describe whole-genome shotgun sequencing, or apply equally to both sequencing methods.

a. starts with libraries of large, overlapping DNA fragments
b. starts cloning and sequencing of short, random DNA fragments
c. uses genetic recombination data to help arrange sequences correctly
d. requires sequences to be annotated after contig assembly
e. requires chromosome fragments to overlap for contig assembly
f. requires subcloning of large fragments into smaller clones for sequencing
g. is a better approach for repetitive sequences

1. Map-based genome sequencing
2. Whole-genome shotgun sequencing
3. Both sequencing methods

Answers

Answer:

1. Map-based genome sequencing: a; c; f; g

2. Whole-genome shotgun sequencing: b

3. Both sequencing methods: d; e

Explanation:

Map-based genome sequencing is a method that makes use of a reference genome sequence in order to determine the relative position of the DNA fragments before they are sequenced. This method is useful to determine the position of repetitive DNA fragments (for example, duplicated genes, repetitive non-coding regions, etc.) and Transposable Elements. Therefore, map-based genome sequencing is a suitable approach for large genomes (which are usually composed of repetitive sequences). On the other hand, in whole-genome shotgun sequencing, DNA sequences are obtained before the correct order of these DNA fragments is known. In this method, the genome is fragmented randomly into small DNA sequences (between 100 and 1000 base pairs), which are subsequently sequenced through the chain-termination sequencing approach (i.e., Sanger sequencing) and finally ordered by using bioinformatic tools that assemble overlapping reads.

Process 2 is known as

Answers

Answer:

Transcription

Explanation:

From the available diagram, process 2 converts, or transcribe or copies DNA nucleotide sequence information into RNA sequence information.

Hence, in this case, the correct answer is TRANSCRIPTION

Body fat in humans includes both essential and storage body fat.

a. True
b. False

Answers

Answer:

true

Explanation:

Answer:

yes that claim is actually true. those are the main fats (correct me if im wrong there)

Newborn infants that are exposed to nitrate poisoning are said to be suffering from also known as .

Answers

Nitrate poisoning in newborn infants causes methemoglobinemia, also known as blue baby syndrome

Answer:

Methemoglobinemia.

Explanation:

can someone please help me with this!

Answers

Answer:

large teeth is dominant on small

Answer:

50%

Explanation:

It's a chart based thing but I don't have one, but it's for sure 50%

what is deposition ?​

Answers

Answer:

it is a geological process where sediments, soil, and rocks are added to a landform or mass

Answer:

Deposition is defined as the removal from an office or the testimony of a witness under oath. An example of deposition is the firing of a person from a government job. An example of deposition is to tell the details of the crime to an attorney before the case goes to court

Explanation:

hope this helps

Other Questions
Which of the following is the furthest away from Earth?The closest starOne of Jupiter's moonsA large asteroid in the asteroid beltUranus When the temperature stays the same, the volume of a gas is inversely proportional to the pressureof the gas. If a balloon is filled with 45 cubic inches of a gas at a pressure of 14 pounds per squareinch, find the new pressure of the gas if the volume is decreased to 15 cubic inches.15A) 28 pounds per square inchB) pounds per square inch14D) 39 pounds per square inchC) 42 pounds per square inch When you go to the movies, a strong light shines through the film and then through one or more lenses. The image you see on the screen is much larger than the one on the film.What kind of image are you looking at on the movie screen? If P= (-3,5) and Q= (1,9), find the equation of the circle that has segment PQ as a diameter What is the relative humidity if the dry bulb temperature is 18 degrees C and the wet bulb temperature is 10 degrees C?Plz answer I'm desperate BRAINLIEST FOR WHOEVER GETS IT !!! Looking over the excerpts shown below, which of the following best compares the themes of the passages? [Mama] would quickly subordinate her own desires to those of the family or the community, because she knew cooperation was the only way to survive. At the same time she placed a high premium on personal privacy, respected it in others and insisted upon it for herself. ...Almost everyone at Manzanar had inherited this pair of traits from the generations before them who had learned to live in a small, crowded country like Japan."Greedy for stories, I devoured books in the children's section of the library. In those days, it was easy to conclude that any tale worth publishing originated in the so-called West, was written in English, and featured North American or European characters.Slowly, insidiously, I began to judge my heritage through colonial eyes. I asked my mother not to wear a sari, her traditional dress, when she visited me at school.I avoided the sun so that the chocolate hue of my skin couldn't darken. The nuances and cadences of my fathers Bangla began to grate on my ears. "Not THAT story again, Dad," I'd say. "I'm reading right now."1. Both passages deal with strong individuals that hold onto what makes them strong and powerful.2. Both passages deal with ignoring one's heritage and beiefs in order to adopt an American way of life.3. Both passages deal with a younger generation shunning the older generation.4. Both passages deal with the treatment of groups during war time and what a country will do to win the war. After your school's team wins the regional championship, students go to the dorm roof and start setting off fireworks rockets. The rockets explode high in the air and the sound travels out uniformly in all directions. If the sound intensity is 1.67 10-6 W/m2 at a distance of 233 m from the explosion, at what distance from the explosion is the sound intensity half this value ALMUERZAS MOSTRAMOS VUELVO CUENTA RECUERDAN Ellos ________ la excursin . Yo ______ el mar. Mi primo ______ las cajas. T ______ en la fiesta. Juan y yo ________ los l Whoever answers correctly gets brainliest. Suppose you take a whole apple pie (because pie is better than cake!!) How do the shape, taste, and the weight of the whole pie compare with the shape, taste, and weight of all the slices together? Review the excerpt from the interview.24/7: Are there some places that are too dangerous to take your family?DR. DOWELL: Yes. A good friend died when we treated Ebola in Uganda. Another friend died when we fought SARS in Thailand. I spent time in Zaire treating Ebola. It was so dangerous that we wore a protective spacesuit.When Birds Get Flu and Cows Go Mad! How Safe Are We?,John DiConsiglioIn what way does the video give more information about SARS?The video shows Dr. Dowell in his protective spacesuit fighting SARS.The video discusses how the CDC was involved in tracing SARS.The video focuses on people who were infected with SARS.The video mentions the symptoms of SARS as a warning. How can you use mental math to multiply numbers by 10? Picture is attached NEED ANSWERS ASAP!!! 20 POINTS IF YOU ANSWER ALL QUESTIONS(NO LINKS, SPAMMING OR GUESSING)What is the name of flower part #10?Captionless Imagesepalpollen tubefilamentStigmaRenewable energy resources are?A resource that cannot be readily replaced by natural means on a level equal to its use.Invisible resourcesRenewable resources that can be naturally restored.All the aboveTo produce perfumes for ManThis is energy that is stored for later use.kinetic energypotential energymechanical energyelectromagnetic energy.When fertilization has occurred the fertilized ovule changes and so does the ovary. What do they turn into?The fertilized ovule turns into the fruit and the ovary turns into the seed.The ovule grows bigger and the ovary withers.The fertilized ovule turns into a seed and the ovary turns into the fruit or pod.The fertilized ovule turns into honey and the ovary turns into nectar.What is energy?1 pointmoving energystored energyrenewable energyThe ability to do work.Wind-pollinated flowers usually have ______ and ________ petals.1 pointbig ... brightsmall .... brightbig ... dullsmall ... dullWhat is the function of nectar?To provide food for the flowerTo attract pollinatorsTo attract animals to disperse the fruitsWhich of the following devices transforms electrical energy into mechanical energy?1 pointAn e-readera fana manual pencil sharpeneriPod Use bear, bare, their, they're, miner, minor, idle, idol in a sentence. Pls dont copy it off goggle!! convert1. 15 Ib = ______ oz 2. 3 T = _______ Ib3. 320 oz = _______ Ib4. 23 Ib =_______ oz 5. 6 T = ______ Ib6. 144 oz = ________ Ib7. 15 T = ________ Ib8. 352 oz = _____ Ib 9. 18 Ib =_______ ozpls pls you will save me Find the are of the following figure find the slope of the line that passes through the given points (7, 3) and (13, 8) The numerator that makes the equation true please help answer both there ez i need an answer