A line through (-2, 1)
With slope = 1/4

Answers

Answer 1

Answer:

y = 1/4x + 1.5

Step-by-step explanation:

To solve a problem like this we can use the formula y - y1 = m(x - x1), in which y1 is the y coordinate, x1 is the x coordinate, and m is the slope.

Equation:

y - 1 = 1/4(x + 2)

y - 1 = 1/4x + 0.5

y = 1/4x + 1.5

Answer 2

Answer:

[tex]y=\frac{1}{4}x+\frac{3}{2}[/tex]

Step-by-step explanation:

A line has the following equation

[tex]y=mx+b\\\\\longrightarrow m=slope\\\\m=\frac{1}{4}\:given\\\\\longrightarrow b= constant\\\\\Rightarrow y=\frac{1}{4}x+b\\\\(-2,1)\rightarrow\:x=-2,\:y=1\\\\(1)=\frac{1}{4}(-2)+b\\\\1=-\frac{1}{2}+b\\\\b=1+\frac{1}{2}\\\\b=\frac{2}{2}+\frac{1}{2}\\\\b=\frac{3}{2}\\\\\Longrightarrow y=\frac{1}{4}x+\frac{3}{2}[/tex]


Related Questions

Let p=x^2+6p=x 2 +6p, equals, x, start superscript, 2, end superscript, plus, 6. Which equation is equivalent to (x^2+6)^2-21=4x^2+24(x 2 +6) 2 ?21=4x 2 +24left parenthesis, x, start superscript, 2, end superscript, plus, 6, right parenthesis, start superscript, 2, end superscript, minus, 21, equals, 4, x, start superscript, 2, end superscript, plus, 24 in terms of p ?

Answers

Answer:

(p+3)(p-7) = 0

Step-by-step explanation:

Given p=x^2+6p and (x^2+6)^2-21=4x^2+24

We are to substitute the the p = x²+6 into the expression as shown;

The expression (x^2+6)^2-21=4x^2+24 will become

(x²+6)²-21 = 4(x²+6)

On substituting p, the expression becomes;

p²-21 = 4p

Subtract 4p from both sides

p²-21-4p = 4p-4p

p²-4p-21 = 0

p²-7p+3p-21 = 0

p(p-7)+3(p-7) = 0

(p+3)(p-7) = 0

Hence the expression in terms of p is (p+3)(p-7) = 0

Answer:

Step-by-step explanation:

For
the function pictured below. Fill in the following values.
a.Domain:
b. Range:
e increasing Interval:
d. Decreasing Interval:
e. Positive Interval(s]
f. Negative Interval (s:
g.Max:
h.min. i.Rate of Change (Slope) [2. 4]:

Answers

Answer:

  1. (-∞, ∞), [-4, ∞), (2, ∞), (-∞, 2), (-∞, 0) ∪ (4, ∞), (0, 4), DNE, -4, 2

  2. y = -|x -4| -2

Step-by-step explanation:

1.

a. the domain is the horizontal extent, (-∞, ∞)

b. the range is the vertical extent, [-4, ∞)

c. the function is increasing where it goes up to the right, (2, ∞)

d. the function is decreasing where it goes down to the right, (-∞, 2)

e. the function is positive where it is above the x-axis, (-∞, 0) ∪ (4, ∞)

f. the function is negative where it is below the x-axis, (0, 4)

g. the function extends to ∞, so has no maximum value

h. the vertex is the low point, or minimum value, -4

i. the function increases from -4 to 0 on the interval [2, 4] so has an average rate of change of (0 -(-4))/(4 -2) = 4/2 = 2

__

2. Reflection across the x-axis negates every y-value. Multiply the given function by -1:

  y = -|x-4| -2

Help Asap ! Find The Measure Of Angle A In The Triangle.

Answers

Answer: m<A = 35

Step-by-step explanation: The sum of the measures

of the interior angles of a triangle is 180°.

So we can setup the equation 3x + 5 + 8x + 65 = 180.

Combining our numbers and variables on the left, we have 11x + 70 = 180.

Now subtract 70 from both sides to get 11x = 110.

Dividing both sides by 11, we find that x = 10.

In the diagram, the m<A is represented as 3x + 5.

Plugging a 10 in for x, we have 3(10) + 5 or 30 + 5 which is 35.

So the m<A = 35.

how old is molly and simba

Answers

5,7 is how old moly and sings are

rjpiejigdorihegourehguhreoghreoghoreghoregregre

Solve for x: 3x + 11 = 41

Answers

Answer:

x=10

Step-by-step explanation:

move all terms that don't contain x to the right side and solve.

What letter would this be?

Answers

Answer:

A

Step-by-step explanation:


1) Solve the problem using the correct steps in PEMDAS.
-5( – 3 – 5) + ( - 40) = —
• -5
• -80
• 8
• 0

Answers

I believe the correct answer is zero

Hopefully this helps

will give branlest for any help that is right

Answers

Answer:

7x+3=2x-6 #4

Step-by-step explanation:

Answer:B

Step-by-step explanation:

help for this qestion and extra point

Answers

Answer:

12.15

Step-by-step explanation:

12.15 is the answer

Able has a younger sister and an older brother. - Able’s age can be represented by x. - Able’s sister is 4 years younger than him. - Able’s older brother is twice as old as he is. - The combined age of all three siblings is 32. How old is Able’s younger sister?

Answers

Answer:9

Step-by-step explanation:

I did the math

Given:

Able's age can be represented by x.

Able's sister is 4 years younger than him.

Able's older brother is twice as old as he is.

The combined age of all three siblings is 32.

To find:

The age of Able's younger sister.

Solution:

Able's age can be represented by x.

Able's sister is 4 years younger than him.

Age of Able's sister = (x-4)

Able's older brother is twice as old as he is.

Age of Able's older brother = 2x

The combined age of all three siblings is 32.

Add 4 on both sides.

Divide both sides by 4.

The age of Able is 9 years. So, age of his younger sister is

Therefore, the age of Able's sister is 5 years.

-5r - 10 = 10
HELP ASAP

Answers

Answer:

r equals -4

Step-by-step explanation:

there's your help


please help
solve the following equation
5/7x 14 =

Answers

Answer:

10

Step-by-step explanation:

multiply the numerators or the top numbers 5/7 * 14/1

14*5=70

divide it by the denominator or the bottom number 70/7=10

4) Divide
(2x2 – 5x + 7) = (x - 3)

Please help me as much as you can.

Answers

Answer:

2x-  5/3x  -7/3

Step-by-step explanation:

yeah

The answer is 2x- 5/3x -7/3

If x+5=20, what does X+10 equal?

Answers

Let's find the value of x

x + 5 = 20

Subtract 5 from both sides

x = 15

x + 10 = 15 + 10 = 25

Show work please 100 points plus brainliest

Answers

Answer:

10. :)

Step-by-step explanation:

calculate the area of the shaded region at right. use the appropriate units.​

Answers

to do this, you most likely have to multiply that numbers that are probably on the sides of whatever.

Use the table below to determine the approximate height of the flag pole.

Help pls due tomorrow

Answers

Answer:

its b

Step-by-step explanation:

...........................

Answer:

B  17.5 ft

Step-by-step explanation:

tangent = opposite / adjacent

tan 35° = h / 25

multiply both sides by 25

h = 25 (tan 35°)

tan 35° = 0.70 (from your calculator)

h = 25 (0.70)

h = 17.51 ft.

Use the vertex formula to find the vertex of the quadratic function f(x) = - x2 + 2x - 6.

Answers

Answer is xF=0 hope this helps

What is the value of 2|6 + p| - 3p^3 when p = -2?

Answers

Answer:p

=

2

,

8

7

Decimal Form:

p

=

2

,

1.

¯¯¯¯¯¯¯¯¯¯¯¯

142857

Mixed Number Form:

p

=

2

,

1

1

7

Step-by-step explanation:

A parking lot is 20 feet long. One tortoise starts at the edge of the parking lot and moves at a rate of 6 feet per minute. Another tortoise starts 4 feet from the edge of the parking lot and moves 2 feet per minute. Write an equation to represent when they will be in the same spot.

Answers

Answer:

Kindly check explanation

Step-by-step explanation:

Length of parking lot = 20 feets

Speed of tortoise which starts at the edge = 6 feets per minute

Speed of tortoise which starts 4 feets from the edge = 2 feets per minute

Equation to represent when they will be in the same spot.

Distance = speed * time

Distance of Tortoise at edge = 6ft/min * t = 6t - - (1)

Distance of the other tortoise = (4 + 2t) - - - (2)

Equating both (1) and (2)

6t = 4 + 2t

6t - 2t = 4

4t = 4

t = 4/4

t = 1

Hence, they'll be at the same spot after 1 minute.

pleaaase help me, it'll give you 50 points and i'll mark you as brainliest or whatever it's called.

Answers

Answer:

3/16

Step-by-step explanation:

What single transformation was applied to triangle AAA to get triangle BBB?

Choose 1 answer:
Choose 1 answer:

(Choice A)
A
Translation

(Choice B)
B
Rotation

(Choice C)
C
Reflection

(Choice D)
D
Dilation

Answers

Answer:

the answer is D

Step-by-step explanation:

Answer:

answer

Step-by-step explanation:

answer is step 5 choice a

How can we find out whether or not a point is on the line?

Answers

Answer:

Plug the points into an equation

Step-by-step explanation:

To find out if a point is on a line, you can plug the points back into an equation. If the values equal one another, then the point must be on a line.

Answer:

To determine if a point is on a line you can subsitute the x and y coordinates into the equation.. If the values equal one another, then the point must be on a line.

Step-by-step explanation:

For example if the x - 3y = 11 and the point is (2, -3) plug in

2 - 3(-3) = 11

2 + 9 = 11

11 = 11

2.) The following figures are similar. Which angle corresponds to angle R?

a. Angle T
b. Angle U
C. Angle V

Answers

Answer:

Angle T

Step-by-step explanation:

Because it’s the closest to Angle R

if I'm right the small triangle is similar to the big one so it would be R&T just like Q&U and S&V go together

Open GeoGebra, and follow the steps below to create and compare triangles using the side-angle-side criterion.

Question 1
Create a triangle of your choice on the grid. Measure two of the sides on the triangle and the angle between the two sides. Record the measurements in the table.

Answers

Answer:

Answers will vary but might resemble this answer based on a triangle called ∆ABC.

ava's turtle is half as old as her parrot. in 10 years her turtle will be ¾ as old as her parrot. write an equation to represent this situation. how old is ava's turtle​

Answers

Answer:I’m not sure but I think the answer is 19

Step-by-step explanation:

10 to power 7 decimal ​

Answers

Answer:

10 mil

Step-by-step explanation: 10x10x10x10x10x10x10= 10,000,000

If the number is expressed in words, first write it down as an ordinary decimal number and then convert. Thus, "ten million" becomes 10,000,000. There are seven zeros, so in powers of ten notation ten million is written 10^7

How long is this line segment?

Answers

What he said is right

A 16-ounce can of carrots for $1.29 OR a 20-ounce can of carrots for $1.49

Answers

Answer: 20 ounce

Step-by-step explanation: 1.29/16=0.080625 1.49/20=0.0745

Answer:

20 ounce, its 20 cents more and it has more carrot.

Step-by-step explanation:

WRITE AN SLOPE INTERCEPT FORM
I need help 1-10 or as much as you can I don’t care just answer pleaseee

Answers

1) y = x

2) y = -(1/5)x + 4

3) y = -6x + 2

4) y = x + 2

5) y = (1/2)x + 2

6) y = -x + 4

7) y = -x + 1

8) y = (3/2)x + 2

9) y = -(3/2)x - 2

10) y = 2x - 1
Other Questions
On the periodic table, why are all noble gases placed in column 18 (8A)?A.Noble gas elements have identical molar masses.B.Noble gases are all rarer than elements in other columns.C.The noble gases only chemically react with other noble gases.D.The valence electron configuration is similar in all noble gas elements. The model represents an equation.What value of x makes the equation true? HELP ASAP WILL MARK BRAINLY BRAINLIEST What stage of cellular respiration uses the high-energy electrons from NADH and FADH2 to form ATP molecules? Krebs cycle Electron transport chain Fermentation Glycolysis 3.Where do you fall in the "life isn't fair, deal with it" debate? Is this a good or bad way ofthinking about your life? Explain your answer. How are the barber and Captain Torres alike? *they both do their jobs extremely wellthey both do their jobs honorablyboth options are correctO neither option is correctWhich answer is correct Solve the following and explain your steps. Leave your answer in base-exponent form. (3^-2*4^-5*5^0)^-3*(4^-4/3^3)*3^3 please step by step!!!! Which option is considered a part of the document that is used to collect specific and predefined information?O text boxO WordArtO SmartArtO form 4. Root cells of plants take in some minerals from the surrounding soil by spendingenergy. After the plant obtains enough minerals to maintain health, the plant willcontinue to absorb minerals from the soil. Which reason best explains why root cellsneed to spend energy in order to transport some minerals into cells? According to this opinion, what does the Supreme Court believe?A minors age does not need to be taken into account when determining if he is in police custody.A minors age must be taken into account when determining if he is in police custody.All accused must be treated equally.J.D.B. was innocent of the crimes to which he confessed. if you ride your bike around the block, returning to the exact point where you started, your displacement is _____m?help please In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop ) essay on my future ambition as a teacher After conquering China, the Mongols created theHan Dynasty.Ming Dynasty.Song Dynasty.Yuan Dynasty. P5.30 Having a secure password is a very important practice, when much of our information is stored online. Write a program that validates a new password, following these rules: The password must be at least 8 characters long. The password must have at least one uppercase and one lowercase letter. The password must have at least one digit. Write a program that asks for a password, then asks again to confirm it. If the passwords dont match or the rules are not fulfilled, prompt again. Your program should include a function that checks whether a password is valid. The concentration of the solute in the solution is the same as in the cell the rational number 9.8 is the best approximation to the tenth of which irrational number?89 squared92 squared96 squared98 squared Which of the following reasons led the Texans to revolt against the Mexican government? A. A tax on cotton? B. Outlawing Slavery? C. Annexation of California? or D. Forcing Texans off their land? Why did slavery come to a halt in the 1750s?