6. PLEASE HELP ME A LOT OF POINTS

6. PLEASE HELP ME A LOT OF POINTS

Answers

Answer 1

Answer:

B

Explanation:

can i get brainliest plz?


Related Questions

HELP IDK THE ANSWER SKSK

Answers

Answer:

The Goldilocks Zone?

Explanation:

The Goldilocks zone is a region that is close enough to the Sun to get the energy, and far enough to not burn up.

Answer: pretty sure thats right

Explanation:

Which of the following is not true about prokaryotic cells?

Answers

Answer:

Prokaryotes lack a true nucleus with well defined nuclear membrane and other membrane-bound organelles. Mitochondria are the double membrane bound organelle and hence is absent in prokaryotes. Mesosome is an extension of the cell membrane presence in the cytoplasm as infolding and serves to increases surface area and as a site for cellular respiration in prokaryotes. Histones are positively charged proteins that serve in the packaging of negatively charged eukaryotic DNA but are absent in prokaryotes.

So, the correct answer is option A.(DNA is complexed with histones).

The statement which is not true for prokaryotic cell is that they are all parasitic. Thus, the correct option is C.

What is Prokaryotic cell?

Prokaryotes are the organisms whose cells lack a nucleus and other membrane-bound organelles. Prokaryotic organisms are divided into two distinct groups which are the bacteria and the archaea, which scientists believe to have the unique evolutionary lineages. Most of the prokaryotes are small in size, single-celled organisms which have a relatively simple structure.

Examples of prokaryotic organisms are blue-green algae, bacteria and mycoplasma. Among the prokaryotes, bacteria are the most common and multiply very fast.

Therefore, the correct option is C.

Learn more about Prokaryotic cell here:

https://brainly.com/question/18348786

#SPJ6

Your question is incomplete, most probably the complete question is:

Which one of the following is not true of prokaryotes ?

(a) They are living cells

(b) They lack a nucleus

(c) They all are parasitic

(d) They are both archaea and bacteria

Which molecule is a source of carbon, hydrogen, and oxygen atoms for making proteins?
O water
O salts
O carbohydrates
O carbon dioxide

Answers

Carbohydrates is your answer because it’s the only molecule that provides energy of the 4 options

Is it possible for you to be more related to one grandparent than another?

Answers

Answer:

No because you should get half the DNA from your parents meaning you should be related to the grandparents equally

Answer:

The question isn't clear, can you restate it ?

Explanation:

What molecules will carry the electrons to the electron transport chain?

Answers

Answer:

electron and nuetrons

The molecules NADH and FADH₂ will carry the electrons to the electron transport chain.

These electron carrier molecules (NADH and FADH₂) are produced during the breakdown of glucose and other energy-rich molecules in the preceding steps of cellular respiration. They carry the high-energy electrons derived from these molecules to the electron transport chain, which is embedded in the inner mitochondrial membrane in eukaryotic cells.

The electrons passed through the electron transport chain ultimately combine with molecular oxygen to form water, which is the final electron acceptor in the chain.

Learn more about the electron transport chain, here:

https://brainly.com/question/33834922

#SPJ4

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers

Answer:

which are the letters with hightlight yellow?

HELP ASAP 20 POINTS!!!!!!!!!!!!
2 ANSWERS

Answers

Answer:

A, and D

Explanation:

its the answer I believe

Answer:

Nitrogen, Calcium

Explanation:

im pretty sure.

Brainliest FIRST ANSWER! of the following is not a sub-atomic particle?

A.Electron
B.Neutron
C.Nucleus
D.Proton

Answers

Answer:

Nucleus

Explanation:

Which of the following actions would you take to remain safe in the lab?
Check all of the boxes that apply.

A bottle of liquid looks like water; you taste it to be sure.

While cutting a screen for an aquarium top, you point the scissors away from your body.

You pipette a liquid using a bulb pipette.

You heat a liquid by placing it in a plastic beaker on a hot plate.

You arrange all lab items neatly and make sure they are away from the edge of the lab table.

Answers

You arrange all lab items neatly and make sure they are away from the edge of the lab table.

You pipette a liquid using a bulb pipette.

The following guidelines should be included in most safety policies because they apply to practically all laboratories. They go on emergency preparedness, appropriate signs, safety gear, how to use lab equipment properly, and fundamental common sense standards.

Make careful to read any safety and fire alarm signs, and in the event of an accident or emergency, heed the directions.Make sure you are completely informed of the evacuation protocols for your building or facility.Make sure you are familiar with the location and proper use of all of the safety supplies in your lab, including eye wash stations, fire extinguishers, first aid kits, and safety showers.Be aware of the emergency phone numbers to call for assistance.Lab spaces with lasers, radioisotopes, and other biohazards need to be adequately labeled with warning signs.When working in the lab, avoid eating, drinking, and chewing gum.Never use laboratory glassware as a container for food or drink.Make sure to inspect your glassware for chips and cracks before each usage. Glassware that is broken should be reported to your lab manager so it can be disposed of properly.Never utilize lab equipment that you have not been given permission or been taught to use by your supervisor.Inform a technician as soon as possible if an instrument or piece of equipment malfunctions while in use or isn't functioning properly. Never attempt to fix a piece of equipment by yourself.

To know more about Lab guidelines visit:

https://brainly.com/question/2232090

#SPJ1

write the names of Institute which involved in research of viruses
plz tell me fast​

Answers

Answer:

The National Institute of Virology, Pune is an Indian virology research institute, and one of the translational science cells part of Indian Council of Medical Research (ICMR). It was previously known as 'Virus Research Center' and was founded in collaboration with the Rockefeller Foundation.

How many atoms of each element are in the chemical formula NH4NO3?

1 nitrogen, 1 hydrogen, and 3 oxygen
1 nitrogen, 4 hydrogen, and 3 oxygen
2 nitrogen, 4 hydrogen, and 3 oxygen
5 nitrogen, 1 hydrogen, and 1 oxygen

Answers

C - 2 Nitrogen / 4 Hydrogen / 3 Oxygen

hope that helps :)

Describe one way the plants in a desert biome are adapted to survive?​

Answers

Answer:

The leaves and stems of many desert plants have a thick, waxy covering. This waxy substance does not cover the stomata, but it covers most of the leaves, keeping the plants cooler and reducing evaporative loss. Small leaves on desert plants also help reduce moisture loss during transpiration.

Explanation: I hope this help's you some!!

Each student in a science class of 25 performed the same experiment. Each student shares their data and it is
recoded on a class data table. Tamara compared the data that she personally collected in her experiment to the
data collected by the rest of her classmates.
Which of the following might indicate to her that her results are valid?

Answers

Answer: three other classes performed the same experiment.

Explanation:

If 5x+4y=58 and 3x + 7y = 67 find the value of ( x + y ) ​

Answers

Explanation:

5x + 4y = 58 ....1

3x + 7y = 67 ....2

....1 × 3 both sides of the equation

15x + 12y = 174 ....3

....2 × 5 both sides of the equation

15x + 35y = 335 ....4

.....4 - ......3 both sides of the equation

35y - 12y = 335 - 174

23y = 161

y = 161/23

= 7

HELPPPPPP ME PLEASEEE

Answers

Answer:

building blocks of life

Cells are the basic building blocks of living things. The human body is composed of trillions of cells, all with their own specialised function. 

what is the relation between weight of the body and weight of the heart​

Answers

300g in males 200g in females

explain how matter behaves differently than energy in a ecosystem

Answers

Answer:

Energy and nutrients are passed around through the food chain, when one organism eats another organism. ... An example of energy flow in an ecosystem would begin with the autotrophs that take energy from the sun. Herbivores then feed on the autotrophs and change the energy from the plant into energy that they can use.

Which statement does NOT accurately describe eukaryotic and prokaryotic cells?

Answers

Answer:

You did not provide any options so i will give some facts that will hopefully help you in figuring out the correct answer.

For prokaryotic cells, the cell wall is a tough, fibrous layer that protects the cell and gives it shape and rigidity.

Prokaryotic cells are found in the domain(s) Bacteria and Archaea.

True: Prokaryotic cells have nucleoids and eukaryotic cells have nuclei.

A prokaryotic cell is distinct from a eukaryotic cell because a prokaryotic cell lacks _a nucleus_.

There is only  _1_ eukaryotic domain, it is Eukarya.

You state that the presence of water could accelerate the growth of bread mold. is this a
a)conclusion
b)analysis
c)hypothesis
d)experiment

Answers

Answer:

C. Hypothesis

Explanation:

Select the correct location on the image.
This diagram shows the functions of different enzymes during DNA replication. Which label would change if this process took place in aprokaryotic cell?

Answers

Answer:

DNA ligase

Explanation:

Answer: The nucleus

Explanation: I got it right on the test.

Help I don’t get it the last one says negative

Answers

Answer:

Negative (Fourth Choice)

Explanation:

According to the question, it says "The flow of electrons is electricity." if the question talks about the electrons, then they are negative, because electrons are negatively charged.

Which process connects glycolysis and the citric acid cycle?
lactic acid formation
acetyl CoA formation
electron transport
Krebs cycle

Answers

The process which connects glycolysis and the citric acid cycle is acetyl CoA formation.

Glycolysis

Glycolysis is the reaction pathway busy which a glucose molecule is converted to two pyruvate molecules with the production of two net ATP molecules.

Citric acid cycle

This is a cyclic reaction pathway in which a mole of acetyl CoA is oxidized to two molecules of carbon (iv) oxide with the production of the reducing equivalents NADH and FADH2 as well as two ATP molecules.

Acetyl CoA formation

The pyruvate from glycolysis is oxidized to an acetyl CoA molecule by the pyruvate dehydrogenase complex. The acetyl CoA produced then enters the citric acid cycle.

Therefore, the process which connects glycolysis and the citric acid cycle is acetyl CoA formation.

Learn more about glycolysis, citric acid cycle and acetyl CoA at: https://brainly.com/question/11125539

Answer:

It's B

Explanation:

I took one for the team.

1. Why were populations able to get so big? What happened that allowed this to happen?

2. What do you think will happen if the populations of humans continued to increase

3. What could happen that could limit the population or cause it to decrease ( Stop growing )

Answers

Answer:

1. reproduction

2. we could run out of food as not enough is produced fast enough

3. lack of food, women and men who are infertile or diseases which can kill people

Number 15 which of the following is a function of carbohydrates?

Answers

Answer:

Option (c) cell wall.  

Explanation:

Carbohydrates helps to forms the cell wall.  Cellulose is a carbohydrate and it is found the plant cell wall.

Which specialized cell type would be found lining the trachea, the part of the body that brings air to the lungs?
A)blood
B)epithelial cells
C)neuron
D)muscle cells

Answers

Answer:

epithelial cells

Explanation:

I hope it works <3

Answer:

Blood

Explanation:

Red blood cells are responsible for transporting oxygen to the different parts of the body.

Which statement is true? a. Earth’s revolution is circular. b. Earth’s revolution is elliptical. c. Earth’s distance from the Sun is constant. d. Earth’s average distance from the Sun is 2 astronomical units.

Answers

Answer:

B

Explanation:

Compare and contrast DNA to RNA, mention 3 points

Answers

Answer:

RNA is single-stranded while DNA is double-stranded. RNA contains uracil while DNA contains thymine. RNA has the sugar ribose while DNA has the sugar deoxyribose.

Please mark me as brainlist.

Answer:

Differences -

DNA is made of sugar deoxyribose, RNA is made of sugar ribose

DNA is a double-stranded molecule, RNA is a single-stranded molecule

DNA is stable under alkaline conditions, while RNA is not stable

DNA stores genetic material, RNA converts information from DNA to proteins

Similarities -

Both store genetic infrmation

Both DNA and RNA consists of sugar, nitrogenous bases, and a phosphate backbone

Explanation:

What speed do thorn bugs move at?

Answers

Answer:

they are not built for speed, and often move quite slowly.

Explanation:

<3

They often goes slow.

(integumentary system)
What type of cells are found in the system?
Are they different from other cells?
How do they work together to form the tissues needed to create the organs for the system?

Answers

Answer:

Its main functions are protection, absorption of nutrients, and homeostasis. In structure, it consists of a keratinized stratified squamous epithelium; four types of cells: keratinocytes, melanocytes, Merkel cells, and Langerhans cells.

Explanation:

Btw is your proflie pic a pic of Taehyung from BTS!??!?!?!?!?!!??!?!?!

Which phrase describes one main feature of the atmosphere

Answers

Answer:

protects earth's surface

I hope this helped you!

Other Questions
(Help please its a multiple choice)En classe, ondes verbes reguliersparlesO etudieJenpas mon frere a la sortie du lycee.O attendsO entendPaul et toi, vousun livre a discuterO regardentO choisissezLa classe et moi nous ____ dans un bus RentrezMontonsTu ne ___ pas avec Joue Chantes Canille et Martin ____ leurs baskets au gymnase Apporte Laissent Lcole ___ une nouvelle bibliothque ConstruitDemandes Ils___ (aller) se promener en ville cet aprs-midi Allent Vont A large company is running a charity drive in which they will donate money proportionally to the amount of money donated by the public. If the public donates $25,000, the company will donate $555. How much money would the company donate if the public was to donate $35,000 ? Viruses use two different cycles of replication, the lytic cycle and the lysogenic cycle. In what way is the lytic cycle different from the lysogenic cycle?A. The host cell is destroyed (popped) immediately.B. The virus recognizes and attaches to host cell.C. The original virus is destroyed.D. The virus injects its DNA into the host cell. What would be the BEST title for this map?A)The Freedom RidesB)The Trail of TearsThe Great MigrationD)The March on Washington do this fast and real answers please Carbon dioxide emissions from vehicles cause a natural warming process as a result of the Earths atmosphere. This is known as the _____ effect.a.) atmospheric b.) carbon dioxide c.) car cultured.) emissions e.) greenhouse which subsequent true/false statement is true? What countries does the Nile River flow through? write a letter to your friend telling about your your plans when school resumes. As in easy Define:Carnivore-Herbivore-Omnivore- Cells are the basic unit of life. Some cells are single-celled organisms and othersare specialized to do a specific function for an organism. Even though cells arestructurally different depending on the organism, all cells have this in common?A. The presence of nucleic acidB. The absence of a nuclear envelopeC. The presence of a cell wallD. The absence of ribosomes 70-21.45=?I need a answer fast and it is worth 25 points Read the passage from "Sugar Changed the World".One of these early Hindu writings, the Atharva Veda, speaks of an archer's bow made of sugar cane. It tells of growing a circle of sugar cane as a kind of sweet protection for a lover, and it includes specific instructions on how to use sugar cane.Which inference does this passage support?A. Hindus who lived in ancient times used sugar the same way we use it today.B. Hindus who lived in ancient times believed that sugar had powerful properties.C. Most Hindus in ancient times had very few specific uses for sugar cane.D. Most Hindus in ancient times searched for new ways to use sugar cane. sorry if its hard to see... Cloth towels should not be used in hand-washing stations because _____.they are too expensive to cleanthey do not dry thoroughlythey may get used for other purposesthey transfer microbes from one person's hands to another What does the chemical formula Cach, show about the compound it represents?O It is made up of one element,It is made up of two elements,It is made up of three elements,It is made up of four elements, What did Europeans and Native Americans Trade? What is x please help quick 35% of what is 28?............ I'll give brainliest to whoever answers this