4. Which statement is an example of how
environmental factors affect gene expression?
A. Your finger becomes callus from writing with a
pencil
B. The amounts of sun, water, and nutrients affect the
growth of a plant
C. Parents with red hair have a child with red hair
D. A red snapdragon flower is crossed with a white
snapdragon flower to produce a pink snapdragon flower.

Answers

Answer 1

Answer:

B. The amounts of sun, water, and

nutrients affect the growth of a plant

Explanation:

Gene expression is the way by which the genes of an organism instructs the production of proteins, which are responsible for the organism's phenotype. However, the trait or characteristics possessed by organisms are not strictly or 100% dependent on the genotypic factors but also on the environmental factors.

Environmental factors are the biotic (living) and abiotic (non-living) factors that affect organisms development and growth. An example is how the amount of sun, water, and nutrients, which are all environmental factors, affect the growth of a plant. Growth in plant, therefore, affects gene expression.


Related Questions

Which organism would look most like organism

Answers

Answer:

the last answer

Explanation:

because f,g,h both come from a so you can be sure

7._________________________ lines your digestive tract and blood vessels. It moves food and blood through your body.

smooth muscle
skeletal muscle
cardiac muscle

Answers

Answer:

Smooth Muscle

Explanation:

In the digestive tract it's called the muscularis mucosa.

please help ::( i wanna pass w good grades

Answers

Answer:

It's catabolism I think

Explanation:

Answer:

Catabolism

Explanation:

Catabolism: the breakdown of complex molecules in living organisms to form simpler ones, together with the release of energy; destructive metabolism.

Each of the following is a density-dependent limiting factor EXCEPT:

- crowding
- predation
- competition
- disease

Answers

Answer:

predation

Explanation:

predation

I hop this answer is correct

Answer:

Disease

Explanation:

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

A
B
5. What is an extinct species? sc.7.L.15.3
a species that blends in easily with its
environment
a species that resembles another species
a species that was unable to adapt and
died out
a species that is bred for specific
characteristics
Copyright © McGraw Hill Education
D

Answers

Answer: A species that was unable to adapt and died out

Explanation: Good luck! :D

What is a simple diffusion?

Answers

Answer:

movement of a solute from an area of high concentration to an area of low concentration

Explanation:

What layer of the Earth does the upper surface of the cross-section represent? Group of answer choices Inner Core Outer Core Mantle Crust

Answers

Answer:

Hello! Your answer is...

The lithosphere is the rocky outer part of the Earth. It is made up of the brittle crust and the top part of the upper mantle. The lithosphere is the coolest and most rigid part of the Earth. The crust is the layer that you live in. The Outer and Inner Cores are hotter. The temperatures of the crust vary from air temperature on top to about 1600. The asthenosphere is the part of the mantle that flows and moves the plates of the Earth.

Explanation:

Hope this helps you! I'm new, but am really smart and nice. Hope you enjoy your time on brainly!

The crust of the Earth, the uppermost layer visible in a cross-section of the planet, is halfway through at this point. The crust, which only accounts for around 1% of the Earth's total volume, is made up of igneous, metamorphic, and sedimentary rocks.

What is the upper surface of the cross-section of Earth?

The rocky exterior of the Earth is known as the lithosphere. It is composed of the uppermost layer of the upper mantle and the brittle crust. You live in the crust of the earth. It is hotter in the outer and inner cores.

The crust varies in temperature from the top air temperature to roughly 1600. The Earth's tectonic plates are moved by the asthenosphere, a region of the mantle.

Therefore, Mantle Crust layer of the Earth does the upper surface of the cross-section represent.

Learn more about Earth here:

https://brainly.com/question/14491367

#SPJ2

The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation

Answers

Answer:

I am pretty sure that the answer is C.

Hopes this helps.

Have a great day!!!!!!!

It is fermentation... bc it’s the total number

PLZ HELP I"LL GIVE BRAINLIEST

Answers

Answer:

gotchu

Explanation:

1. His symptoms consist of difficulty walking and an abnormal gait (pattern of movement such as walking, running, etc)

2. a. one purpose of the blood test was to test his creatine kinase enzyme to see if there were any medical conditions connected to the way he was walking and why it was abnormal

b. the other purpose is to be sure that he has something wrong with his gait. If he does have a medical condition, it was best to see if he had it early on to treat it faster

3. the function of dystrophin gene connects to the cytoskeleton of a fiber which has to do with brain function; we need that to walk. For DMD, that is a condition that alters the way people walk.

4. DMD is inherited from family's genes, so he got it from his birth family probably from his dad's part of the family as DMD effects men more than women

5. It is pretty likely as this medical condition is inheritably passed on. It is likely that his grandchild will get DMD

6. To treat DMD to the best of the ability since there isnt a cure, they could participate in physical therapy and steroids

what would the chromosome to the right be called?

Answers

Answer:

The two identical chromosomes that result from DNA replication are referred to as sister chromatids. Sister chromatids are held together by proteins at a region of the chromosome called the centromere. Chromosomes undergo additional compaction at the beginning of mitosis.

Explanation:

Based on the position of centromere and length of chromosomal arms, the chromosomes are classified into 4 groups:

(1). Telocentric chromosomes.

(2). Acrocentric chromosomes.

(3). Sub-metacentric chromosomes.

(4). Metacentric chromosomes.

A 154-lb adult man performs a moderate level of physical activity and regularly consumes 2700 Calories a day. State whether the weight of the man will most likely decrease, increase, or remain the same. Use information from the data table to explain your answer.

The weight of the man will...
Explanation...

Answers

Answer:

Increases.

Explanation:

A 154-lb adult man regularly consumes 2700 Calories a day and performs a moderate level of physical activity, the weight of that individual increases because a 154-lb adult man needs only 2450 Calories a day and that person consumes 2700 Calories a day which is higher than their needs so these extra calories stored in their body and as a result the weight of that person increases.

what is the genotype for: A man normal for blood clotting:

Answers

Answer:

Genotypes: A man with hemophilia is XhY where h = hemophilia gene and H = the normal gene. ... Her genotype must be: XhXH and NOT XHXH We can use a Punnett square to show the probability of a daughter or son having hemophilia.

please answer this urgent ​

Answers

Answer:

i think its a turnip because of its appearance

i believe this is a radish it looks completely similar to one

How is fish adapted? Write any two adaptational characters of them.​

Answers

1.Grew gills
2.Grew tails

Surface mining is less dangerous and more profitable than subsurface mining

Answers

Answer:

Surface mining is the extraction of mineral and energy resources near Earth's surface by first removing the soil, subsoil, and overlying rock strata. ... Surface mining disturbs the land more than subsurface mining, but subsurface mining is more expensive and dangerous.

Explanation:

PLZZ HELP IM DOING A UNIT ASSESMENT!!!!
What types of cells would contain cell walls and what types of cells would contain a cell membrane?

Answers

They have walls plants have walls

Answer:

I agree with the other person

have a good day :)

Explanation:

the ___severs as a relay station between the hindbrain and the forebrain.
A. forebrain

B. Midbrain

C.cerebral cortex

D. hindbrain

Answers

Answer:

B. Midbrain

Explanation:

I'm pretty sure this is it.

the answer is the midbrain cuz u can cross of forebrain and hindbrain and the cerebral cortex doesn’t apply so it’s B

Pls, I need help with this! Biology Thank you :)

Answers

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

The North Pole and the South Pole are

A:Classified as tundra biomes

B: Not home to any animals

C: not classified into major biomes.

D: Part of Aquatic Ecosystems​

Answers

D part of aquatic ecosystems

Answer:

A

Explanation:

classified as tundra biomes

why do people like sparkling water?

Answers

Answer:

maybe they think it will make them magical?

Explanation:

Describe all the tissues and cell types that are found in a leaf and describe how these individual parts work together to accomplish processes of photosynthesis.

Answers

Explanation:

While individual plant species are unique, all share a common structure: a plant body consisting of stems, roots, and leaves. They all transport water, minerals, and sugars produced through photosynthesis through the plant body in a similar manner. All plant species also respond to environmental factors, such as light, gravity, competition, temperature, and predation.

Astrology, look at the screenshot

Answers

Answer:

the day would get shorter.

hope it helps.

Answer:

year would get longer

Explanation:

Which kind of worm is sometimes used to prevent blood clots?

planarian
leech
fluke
hookworm

Answers

Answer:

Leech

Explanation:

leeches suck our blood so when a blood clot appears they can fix it by sucking our blood so the blood does not effect.

Answer:

a leech i got it correct on edu!

Explanation:

What are the potential advantages and disadvantages of a major shift from the hard or traditional path of energy development to the soft or visionary path?

(These were the corresponding textbook pages, if needed) Please read the following from the textbook Environmental Science:
7th Edition - Chapter 17
9th Edition - Chapter 14

Answers

Answer:

Advantages of following the soft path, the argument here is alternative sources of power such as hydropower, geothermal energy , wind energy , and photovoltaic cells must be developed. This provides a alternative source to remain in a healthy environment and also function as the society we currently live in using the hard path.  Disadvantages of following the hard path result with future generations fearing over the irreversible damage of climate change and the damage done to our atmosphere. The hard path argue that we should continue to operate in the future as we have in the past, except more efficiently. This is close to impossible and will only continue the negative effects the hard path( the path we have been following) results in. The major shift determines the outcome of this world, the futures worries or reliefs and ultimately the survival of humans.

Explanation:

the question are in the Picture:) Please help me :) ​

Answers

Answer:

Birds

Explanation:

1. Wings

2. Flight feathers and beak

3. For survival purposes

Which of the following is a macronutrient?
A) iron B) boron C) Calcium D) Manganese

Answers

C. calcium is your answer

Explain the role that hooved animals, such as cows, play in regenerative farming.

Answers

Answer:

I hope this helps

Explanation:

As animals move, their hooves break up the soil, compacting inedible plants and allowing nutrients and sunlight to new plants—essentially speeding up the building of soil organic matter, with crushed leaves and stalks creating a natural mulch. This better equips the soil for germinating seeds.

I need this ASAP it’s on a.p.e.x

Answers

The correct answer is C. Gardeners choose which plants they let reproduced based on the plant traits.

Explanation:

In general, selective breeding involves the intervention of humans in the reproduction of species, this includes mainly plant and animal species. Moreover, in selective breeding, humans choose which specific species or individuals reproduce to favor certain traits. For example, a farmer might allow only the biggest cows to reproduce because this will lead to bigger calves. In this context, the option that shows selective breeding is C because this shows the intervention of humans in reproduction by selecting the individuals that will reproduce.


True or False.
A group of the same species of living things in an area is a population

Answers

Answer:

True.

Explanation:

A population is a group of organisms of the same species that live in the same area at the same time

Answer:

True!

Hope this helps.

Other Questions
Learning Task 7: Complete the paragraphs below by supplying the missing terms.Select from the given choices below. Please can any answer this for me. The points (1,1) and (5,5) fall on a particular line. What is its equation in slope- intercept form 1. Each letter in VALENTINE is written on a separate piece of paper and put into a bag.You randomly choose a piece of paper from the bag. Find the probability of choosing anE 4. How is a lead storage battery recharged?a. It is heated up.b. The pressure on it is increased.c. A direct current is applied to it.d. A magnet is held close to it. Solve the given differential equation by using an appropriate substitution. The DE is a Bernoulli equation. t2 (dy/dt) + y2 = ty Last Sunday 1,575 people visited the amusement park. 56% of the visitors were adults, 16% were teenagers, and 28% were children ages 12 and under. Find the number of adults, teenagers, and children that visited the part. What statement is an example of a paradox?A. His sister is awfully pretty B. You have to be cruel to be kind C. The elephants name is Tiny D. It was dark and dim in the doorway please help i dont know how to solve helpppppppppppppppppppppppppp Sabes por qu (irse) Elisa sin despedirse? Which of these clues helps you understand what "browse" means?A.the world.B.may be surprised.C.looking through.D.crickets and worms. Use the graph to answer the following question.For which interval is the function increasing and changing by a constantrate of change?A. between 2 and 4B. -2 and 0C. between -4 and -2D. between 0 and 2 please help no spam answers!!! A battery has an emf of = 15.0 V. THe terminal voltage of the battery is Vt = 11.6 V when it is delivering P = 20.0 W of power to an external load resistor R. (a) What is the value of R? (b) What is the internal resistance r of the battery? Why was Lowell, Massachusetts founded in the early 1820s? what are the different typhoon categories and their relationship to their speed and extent of damage Need help ASAP Thankss + BRAINLIST only for correct answers plzzz help will give brainiest select the most precise name of quadrilateral MNOP given the coordinates of M N O P Describe the key events leading up to the Great Depression. Explain how the country recovered from the Depression. Use information from the lesson in your answer.