3.) The comparison between ships and gulls adds to the development of the following passage
(paragraphs 4-5) mainly by explaining that.
We watched until the boats became a row of tiny white gulls on the horizon. Our vigil would end when
they slipped over the edge and disappeared. You had to squint against the glare to keep them sighted,
and with every blink you expected the last white speck to be gone.
But this time they didn't disappear. They kept floating out there, suspended, as if the horizon had
finally become what it always seemed to be from shore: the sea's limit beyond which no man could
sail. They floated a while, then they began to grow, tiny gulls becoming boats again, a white armada
cruising toward us.
A. the boats are harmless
B. the boats normally become small-looking before they disappear beyond the horizon
C. gulls usually occupy the horizon when the boats disappear
D. government ships are not intimidating in the distance

Answers

Answer 1

Answer:

B. the boats normally become small-looking before they disappear beyond the horizon

Explanation:


Related Questions

Plsss help me
Where ___________ (put) my bag? I cant find it anywhere!
Should i use where have you put or where did you put

Answers

Answer:

Where did you put it

Explanation:

Answer:

Where did I put my bag?

Explanation:

The final stanza of Williams’s poem, “Landscape with the Fall of Icarus” is about the painting Landscape with the Fall of Icarus by Peter Brueghel. The poem ends with: "a splash quite unnoticed/this was/Icarus drowning."

Using these three lines, predict what you think the theme of the poem could be. After you have written down 2-3 ideas, use the web to briefly research Icarus and Brueghel and write a paragraph about what you learn about the theme of the poem in your journal.

Answers

Answer and Explanation:

According to the final three lines of the poem, we can see that the theme of the poem to death is irrelevant to the world and presents itself as an unnoticed splash for those who are not participating in this moment, but are following their lives in the best possible way. In other words, we can say that death is insignificant for those who are alive.

According to the poem and the illustration we can conclude that our suffering, represented by the pain and agony that Icarus felt, only concerns ourselves and only impacts our own life, since the people around us are busy with their own activities, however this does not diminish the size and strength of what we are going through.

Answer:

According to the final three lines of the poem, we can see that the theme of the poem to death is irrelevant to the world and presents itself as an unnoticed splash for those who are not participating in this moment, but are following their lives in the best possible way. In other words, we can say that death is insignificant for those who are alive.

According to the poem and the illustration we can conclude that our suffering, represented by the pain and agony that Icarus felt, only concerns ourselves and only impacts our own life, since the people around us are busy with their own activities, however this does not diminish the size and strength of what we are going through.Explanation:

Why did the man consider killing the dog?
"To build a fire"

Answers

Answer:

The man decides to kill the dog and use its body heat to restore the feeling in his hands, after which he might build another fire.

Explanation:

What element of a story reveals the
conflict
1.setting
2.character
3.theme
4 point of view
5plot​

Answers

The correct answer is plot

It’s not proof read as u go! Plz help!! When brainstorming it is important to
avoid judging your ideas
proofread as you go
write down only your good ideas
think about your final draft

Answers

Answer:

Explanation:

when brainstorming its important to make sure your final answer is relating to the passage, make sure to be thinking on one topic and not multiple at once, it will confuse you.

During the night of the awards, I was nervous. The entire team had nominated Chris for most improved player. They also nominated me. I looked at Chris the moment our category came up. He looked back at me, and we were both stunned when they read the name. They gave the award to _______. What information belongs on the blank line

Answers

Answer:

do you want the name or the info

Explanation:

Answer:

thats hard

Explanation:

Read the passage from Of the Wisdom of the Ancients.

Let us now consider his [Cupid’s] attributes. He is described with great elegance as a little child, and a child for ever; for things compounded are larger and are affected by age; whereas the primary seeds of things, or atoms, are minute and remain in perpetual infancy.

Most truly also is he represented as naked: for all compounds (to one that considers them rightly) are masked and clothed; and there is nothing properly naked, except the primary particles of things.

Bacon lists Cupid’s attributes in order to

show that Cupid is real.
prove that Cupid is a child.
disprove the existence of the atom.
compare them to the features of the atom.

Answers

Answer:

i got A)

Explanation:

not sure if that's right

Bacon lists Cupid’s attributes in order to compare them to the features of the atom. Therefore, option D is correct.

What are atoms?

Atoms are the basic units of matter that make up all physical substances. They are the smallest particles of an element that have the properties of that element. Atoms are composed of a central nucleus. The nucleus is made up of positively charged protons and neutral neutrons, surrounded by negatively charged electrons.

The number of protons in the nucleus determines the element to which the atom belongs. For example, an atom with one proton is hydrogen, while an atom with six protons is carbon. Atoms can combine with other atoms through chemical bonds to form molecules, which are the building blocks of all types of matter. Thus, option D is correct.

Learn more about atoms, here:

https://brainly.com/question/1566330

#SPJ5

Our greatest memories are not those with people but those we share alone in silence thinking of our future.

False
True

Answers

Answer:

False

Explanation:

In order to make unforgettable moments that you will cherish for the rest of your life it needs to have been something that you enjoy doing with others and not just moping in a room together. I mean unless that's something you enjoy doing.

In The Return what are the metaphors in the story?

Answers

answer:

a small action has had tremendous repercussions. thunder is truly the major metaphor of this story, but it is not just about the way the dinosaur moves. it is also a metaphor for the impacts that our actions can have on the world.

Explanation:

credits: online source

Please please help me!!!

Answers

Answer:

Adverb

Explanation:

Which sentence is an example of objective writing?
Arrowheads and spearheads are some of the most familiar objects made by Native Americans.
My friends and I even tried to make an arrowhead by scraping a rock on the sidewalk.
One time when I was on vacation with my dad, we found an arrowhead.

Answers

Answer: Arrowheads and spearheads are some of the most familiar objects made by Native Americans.

An example of objective writing is "Arrowheads and spearheads are some of the most familiar objects made by Native Americans."

What is objective writing?

The convention of 'objective' writing is that arguments use impartial language, which is not personal, judgmental, or emotive. Objective language, therefore, is considered fair and accurate. It avoids exaggeration and bias, and shows respect for the views of others.

Objective writing typically makes use of passive language, as passive language removes the actor from the sentence. For example, instead of saying 'I conducted the necessary research', say 'the necessary research was conducted. '

Objective statements and observations don’t include people’s personal views and preferences, known as biases.

Therefore, An example of objective writing is "Arrowheads and spearheads are some of the most familiar objects made by Native Americans."

Learn more about objective writing, here:

https://brainly.com/question/19771079

#SPJ3

can someone please help me with this?

Answers

Answer:

a

Explanation:

Answer:

unrefined

Explanation:

unrefined mean “not processed to remove impurities or unwanted elements.”

J. Look up the meaning of culture in a dictionary. Which of these words
are related to the culture of a region? Give reasons for your choice.
1. architecture architecture aree culture
every leegida
of
2. children
3. literature
politics
food
nature​

Answers

Answer:

Culture is the characteristics and knowledge of a particular group of people, encompassing language, religion, cuisine, social habits, music and arts. ... The word "culture" derives from a French term, which in turn derives from the Latin "colere," which means to tend to the earth and grow, or cultivation and nurture.

Which word correctly completes the sentence?

Select the word from the drop-down menu.

The library's fiction books can be found over
Choose...

they are
their
there
they're

Answers

The correct answer is “There”
The correct answer is there

In chapter 2 of When Things Fall apart, what do we learn about both Okonkwo through the use of flashback? Explain your thinking.

Answers

Answer:

The flashbacks reveal Okonkwo's images of his father. The flashbacks help develop the character of Unoka. The reader can get a visual image of Unoka. Likewise, the reader can understand the relationship between Okonkwo and his father. It is easy to see why Okonkwo fears becoming like his father. It is easy to see why Okonkwo despises the father he knew as lazy and dishonorable.

Explanation:

Which scenarios are examples of internal conflict? Select two options.

a character fighting a battle against an enemy
a character feeling guilty about a choice
a character weighing a decision
a character getting into a fight with a friend
a character protesting a new law posed by the government

Answers

Answer:

a character feeling guilty about a choice

a character weighing a decision

are the answers

The situations/scenarios that demonstrate 'internal conflict' would be:

B). A character feeling guilty about a choice.

C). A character weighing a decision.

Conflicts are characterized as a 'disagreement among two combatant forces.' The conflicts are of two types:Internal conflictExternal conflictInternal conflict is the struggle that a character undergoes due to the opposition among his own values, decisions, desires, or beliefs.While external conflict involves a dispute between two characters, a character and society, society and nature, etc. Thus, a character scuffling between his own decisions and feeling guilty for making a choice demonstrates internal conflict.

Hence, options B and C are the correct answers.

Learn more about 'conflict' here:

brainly.com/question/1869421

50 POINTS + BRAINLIEST "how politicians or people in charge of a democratic government turn it into a totalitarian government." GIVE ME AT LEAST 3 SENTENCES AND EXPLAIN PLS I NEED SOMEONE

Answers

He surge said s had been shot by a center in line with a

Answer:

Explanation:

Do you live in the United States? If you do then unfortunately you are witnessing how it happens.

It begins in most cases with hatred. There are two sides to an issue. Men of good faith cannot listen to someone with the opposite point of view.

I grew up in an era where the left and right would compromise with each other. The debate was often furious but when it ended, men of good intentions knew that the battle was over. I don't think that's true any longer. I think the battle just keeps on going with new issues to be fought over.

PART B: Which of the following best represents an example of the
answer to Part A?
A "Wentworth, reportedly ignoring the protests of his
classmates, got behind the wheel of his turbocharged Supra
2000GT after consuming half the contents of a bottle of alcohol
at a friend's party." ( Paragraph 2)
B "Wentworth later said the only thing that got him through that
dark time was thinking of his rich, well-connected loved ones! (
Paragraph 6)
C "To think that I was that close to seeing that there is an entire
society with its own laws and standards outside my protected
sphere of wealth and privilege-it's frightening.... It almost
makes you consider your actions and their impact on others.
Almost." ( Paragraph 12)
D "The other four victims of the crash remain in intensive care at
St. Peter's University Hospital, suffering from conditions
ranging from poor to lower-class." ( Paragraph 14)

Answers

Answer: A

Explanation:

The answer choice that represents an example to the answer in Part A is option A.

'What is a Supporting Detail?

This refers to the use of evidence to prove that a claim is true in a given statement with the use of either factual or statistical data.

Hence, we can see that from the complete text, there is the narration of Wentworth about the actions which he took when he got into a supercar against the advice of his friends after drinking.,

Read more about supporting details here;
https://brainly.com/question/884525

The New Baby
For 12 wonderful years, Cara had enjoyed her position as the youngest of five children, the baby of the family. But for the past nine months Cara had felt her special place slipping away as the family prepared for her oldest sister to give birth. Now, Cara’s parents would become grandparents and there would be a new baby to fawn over, which had not happened since Cara was born. Cara worried that her mother would forget about her and spend all her time with the new baby. She was less than thrilled as she rode the elevator to the hospital’s ninth floor.

The room was so full of family members and flower bouquets that Cara had trouble seeing the hospital bed. Angela, Cara’s sister, sat propped up by pillows. She cradled a squirming pink bundle in the crook of one arm. She grinned when she saw Cara and her parents and turned the pink bundle towards them. Only the baby’s face was visible. Her hands punched out under the swaddling.

Cara’s mother was the first to hold the baby. She smiled and cooed at the baby. Then the baby was being passed to Cara, and she was face-to-face with her new niece. The baby squirmed a bit and then opened her eyes and looked right at Cara. The baby cooed at Cara, and Cara smiled at her niece, thinking that becoming an aunt might be wonderful after all.

2. Which of these best summarizes the passage?
a. Cara's sister is having a baby, and Cara is concerned that she will be overlooked, but after meeting her niece Cara is excited to be an aunt.
b. Cara rides the elevator in the hospital with her parents on the way to visit her sister, who has just had a new baby.
c. Cara's mother is the first to hold the new baby, and Cara waits patiently to have her turn to hold the baby.
d. Cara's sister is having a baby, and Cara is traveling with her parents to visit the baby on the ninth floor of the hospital.

Answers

Answer:

A: Cara's sister is having a baby and Cara is concerned that she will be overlooked, but after meeting her niece Cara is excited to be an aunt.

Explanation:

What is a difference in how the two selections portray fathers?

Answers

Answer:

the father in “To a Daughter with Artistic Talent” seems caring, the father in the excerpt from Big Fish seems self-centered.

Explanation:

Help me please I’ll give brain

Answers

The second one please mark brainlyest

Answer:

option 3 sounds reasonable

Is the quote on Night "The stomach alone was measuring time" a metaphor

Answers

Answer:

No

Explanation:

This is an example of personification due to non living objects doing human activities

‘The duties of a teacher are neither few nor small, but they elevate the mind and give energy to the character' write an article. Plz answer quick

Answers

The correct answer to this open question is the following.

This would be our short article.

Teachers at school play one of the most important roles in society.

More than ever, the teacher has the big responsibility to form students and prepare them not only in the academy but for their professional lives.

That is the difficult part for teachers because, in today's environment, they have to play different roles. Educators, of course, but many times they have to be coaches, friends, counselors, or parents.

That is why the duties of a teacher are neither few nor small, but they elevate the mind and give energy to the character.

Teachers are role models, and that is a great responsibility. They are public figures that have to set the example of high moral values and behavior.

In good times and bad times, students know they can trust the teacher.

And it doesn't matter if the teacher had a good day or a bad day if the teacher has problems or not. By the time he/she is on the school premises,  the teacher assumes its role of educator. As soon as the teacher is in the classroom, he/she has to forget his problems. He is focused on the task at hand. With love and passion.

That is the reason why teachers are one of the most important professions in the world. Although they do not receive high salaries, they are committed to doing the work with passion.

Although the student does not value or recognized the teachers' efforts, it is a beautiful profession with many personal gratifications.

Write a how to prompt on how to make anything like a food or handcrafted item. (Thank you if you answer!)

Answers

Answer:

1. how to write a prompt

2. how to build a rocket

3. how to cure corona virus

Explanation:

This question is for everyone that chooses to help people here instead of playing on their phones or watching television. How are you today? Why do you do this? and thank you for helping people get through school. I wouldn't have made it without this site.

Answers

Answer:

Im good, just answering some questions. I do this because I need to build up points to ask my own questions. No problem, here to help.

Explanation:

I do this because I want people to feel relieved that they got an answer from someone because I know that sometimes it could be stressful

Can someone pls help me fill out this? Thank you!

Answers

Answer:is it just like head stomach and legs..?

Explanation:

someone please help !!!

Answers

Sorry couldn’t attach the link but I can put it here

Cutly..wwww.web good luck!

ANSWER FAST WILL GIVE BRAINLY!!!

1. Weary is to tired as shaky is to [ ].
2. Depression is to sadness as [ ] is to suspicions.
3. Afraid is to frightened as majestic is to [ ].
4. Hit is to miss as aware is to [ ].

Answers

1. Nervous
2. Paranoia
3. Not sure
4. Unaware

Answer:

Explanation:

1. tremulous

2. skeptical

3. glorious

4. liberal

can you give me at least ( 2 examples ) on suffix and prefix please ? ​

Answers

Answer:

Suffix: -ing, -ed

Prefix: pre-, un-

Explanation:

Hope this helped!

Based on context clues in this sentence, what is most likely the meaning of the word disparage? When running for class officer, you are not allowed to disparage the other candidates; if you talk about them at all, you are only allowed to say nice things. O A. To insult O B. To contradict O C. To campaign O D. To oppose​

Answers

Answer:

A

Explanation:

Answer: A

Explanation: it says you are to say nice things so the answer would be the oppoisiteof nice

Other Questions
What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks. If 2 cups makes 6 servings, how much makes 2 servings? shawtys been simping for so long.. do you think hunter-gatherers are still around today? what makes you think that? Hi, I am very stuck on questions 17 and 18. Can someone help please? Thanks In which quadrant does the point with c ordinate (4, -3) lie? Which student has the greater median test score? I have to study for a test. It's for data management. Does anyone have tips? (Grade 7) PLEASE HELP ME WITH ALGEBRA! THANK YOU Explain how Japan took control of Manchuria.