Answer:
Adopting sustainable and environment friendly practices
Explanation:
Sustainable and environment friendly practices allows an individual to use available resources without depleting them and hence even the future generations have adequate supply of natural resources. Afforestation and conservation of water resources specially the potable water sources need to be started immediately with massive force.
How did the findings from Hershey and Chase’s bacteriophage experiments likely influence the Meselson-Stahl experiment, and how might Meselson and Stahl’s results help scientists understand how damaged DNA can be inherited by future generations?
Answer:
c, just took the test
Explanation:
Organisms can pass on their genetic information through asexual reproduction. Asexual reproduction is a form of reproduction that involves ______ parent.
Answer:
1
Explanation:
the prefix A- means one
What are ways that biodiversity loss can be reduced?
Select all that apply.
keeping seeds in seed banks
controlling invasive species
captive breeding
fragmenting habitats
Help FINAL EXAM please
Why is it important that the seedling’s true leaves grow quickly?HURRY IM BEING TIMED
to help disperse seeds to areas where they can grow
to shield the seedling from too much water or rain
to protect the seedling from receiving too much sunlight
to make food for the seedling’s continued growth
Answer:
The correct answer is - to make food for the seedling’s continued growth.
Explanation:
The true leaves that emerge from the seedlings are the leaves that are capable of performing photosynthesis and start generating food and energy. These support the plant for the rest of its life in terms of food and energy.
Seedlings grow from the soil, two leaves in beginning called cotyledons that are not the true leaves and not able to perform photosynthesis and generate their food for the seedling’s continued growth.
2 paragraphs about Ecosystems: What is an ecosystem?
Answer:
An ecosystem is a geographic area where plants, animals, and other organisms, as well as weather and landscapes, work together to form a bubble of life.
An ecosystem is a community of living organisms in conjunction with the nonliving components of their environment, interacting as a system. These biotic and abiotic components are linked together through nutrient cycles and energy flows.
Please help.
Measures to prevent landslides.
I need 10 points.
Answer:
deleted?
Explanation:
whaaaat how can youbask
How does air pollution affect the ecosystem?
Answer:
The deposition of acidifying air pollutants causes acidification of surface waters (lakes, rivers and streams) and forest soils, leading to loss of nutrients such as potassium and magnesium from soils and the release of toxic aluminium into soils and waters, resulting in adverse effects on animals and plants.
Explanation:
FREE BRANLIEST IF YOU ANSWER A foul ball can be caught by the defensive team for an out.
Answer:
TRUE!! IT CAN
Astronomers have made great strides in sending probes out to other planets and moons in our solar system. If they were to find a living creature some place other than Earth, how could DNA analysis help them better understand the organism? Explain in 1–2 sentences.(2 points)
Answer:
It could help them understand what ancestors they came from and what species they are most related to.
Explanation:
Over time, a series of random occurrences can cause an allele to become more or less common in a population. This is called . When a population is severely reduced by an environmental disaster such as a fire, the result is a due to the reduced genetic diversity of the survivors. 3. The can occur if a small group of organisms migrates to a new location and becomes isolated from the rest of the population.
Answer:
Over time, a series of random occurrences can cause an allele to become more or less common in a population. This is called Genetic drift.
When a population is severely reduced by an environmental disaster such as a fire, the result is a Bottleneck effect due to the reduced genetic diversity of the survivors.
The Founder effect can occur if a small group of organisms migrates to a new location and becomes isolated from the rest of the population.
Explanation:
Genetic drift is an evolutive force. It is the random change that occurs in the allelic frequency of a population through generations. Its effects are harder in a small-sized population, meaning that the magnitude of this change is inversely related to the size of the original population.
Genetic drift results in some alleles loss -including the beneficial ones-, while some other alleles get fixated. Low-frequency alleles are the most likely to be lost. The changes produced by genetic drift accumulate in time and results in a loss of genetic variability within a population.
Genetic drift affects a population and reduces its size dramatically due to a disaster or pressure -bottleneck effect- or because of a population split -founder effect-. The bottleneck effect most likely affects smaller populations.
The bottleneck effect -a case of genetic drift-, mostly affects smaller populations after the occurrence of a natural disaster or some human action -such as extensive hunting, for instance-. These events might act as a pressure that reduces significantly the number of individuals in a population. In these situations, some alleles are lost, and the survivors have a different genetic charge than the one of the original population. There might be a reduced genetic variability, with a possibility of developing a peculiar allelic component. If the survivors in the population carried or developed a mutation, probably this mutation passed from generation to generation. Founder effect refers to the origin of a new population from only a few individuals that are coming from a bigger-sized population. These founder individuals, which are carrying some of the genes of the original population, settle down in a new area and reproduce. The new and small population might or might not be genetically representative of the original one. Some rare alleles might be exceeded or might be lost by complete. Consequently, when the small population increases in size, it will have a genetically different composition from the original one. In these situations, genetic variability is reduced, and there exists the possibility of developing a peculiar allelic composition. When the number of individuals that originated the new population is low, the founder effect will be very extreme because the genetic drift effects are inversely proportional to the original number of individuals.When baking an empty pie crust
o poke holes in it
o weigh it down
o both choices
Answer:
I think the answer is C
Explanation:
100 points (50 each) How do workers decide when to set a controlled burn, and how do they know if they have been successful?
Answer:
It is very important to have the latest and most updated weather conditions available before starting the burn. Relative humidity is an important factor to consider when planning a controlled burn. If the relative humidity is below 50%, the dryness of the grass is prone to causing very hot fires
Why aren't human hunters a threat to polar bears anymore?
Its because the Governments of the Arctic States are now regulating such people by creating laws, restrictions and quotas to polar bear hunting. Some of those are:
-Amount of Polar bears that can be hunted
-Restriction to hunting certain age or gender
-Native people only being allowed to hunt them (excluding Canada) etc
Even capturing has quotas too. Those are:
-Who takes the polar bear
-Amount of Polar bears that can be taken
-The Life they will have while in captivity
Hello! Offering 25 points. I need it urgently.
The somatic nervous system transmits sensory and motor signals to and from the central nervous system. The autonomic nervous system controls the function of our organs and glands, and can be divided into the sympathetic and parasympathetic divisions.
,
In holly trees, Red fruit (R) are dominant to white fruit (r), and spiny leaves (L) are dominant to smooth leaves (l). Complete the dihybrid Punnett Square to figure out how many of the new holly trees from this cross would be excpected to have white fruit and smooth leaves??
A. 1
B. 2
C. 3
D. 9
Answer:
All answers are in the image
DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019
Answer:
Please find the answers to the following questions below:
Explanation:
1. DNA stands for deoxyribonucleic acid
2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.
3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.
4. Three (3) letters are in the code of DNA. These three letters make up a codon.
5. Adenine - Thymine
Cytosine - Guanine
6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC
7. Proteins are a part of the structural composition of the body
Proteins serve as catalyst for biochemical reactions
Proteins are source of nutrients
8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.
9. DNA is a molecule that stores genetic information in the cell of an organism.
Please help me with this!!
1. Which process plays a part in genetic recombination? A. Asexual reproduction. B. Cytokines. C. Independent assortment. D. Mitotic division.
2. Which correctly lists the following terms in order from smallest to largest? DNA, chromatin, chromosomes, nucleosomes.
A. Chromatin, DNA, Chromatin, nucleosomes
B. Chromosomes,DNA, Chromatin, nucleosomes
C.DNA, nucleosomes, chromatin, chromosomes
D. Nucleosomes, DNA, chromatin, chromosomes
3. In a triploid organism, how many alleles are present for each gene per cell?
A. 1
B. 3
C. 6
D. 9
I) Independent assortment.
II) Nucleosomes, DNA, chromatin, chromosomes.
III) 3.
EXPLANATION:➻ Recombination scrambles pieces of maternal and paternal genes, which ensures that genes assort independently from one another.
➻ We know that Chromatin is a complex of DNA and proteins that forms chromosomes. Chromatin looks like beads on a string. The beads are called nucleosomes. Each nucleosome is composed of DNA.
➻ Triploids with three different alleles can easily be detected because they have a unique phenotype.
The process involved in genetic recombination is INDEPENDENT ASSORTMENT. The correct order from smallest to largest is DNA, nucleosomes, chromatin, chromosomes. In a triploid organism, there are 3 ALLELES for each gene.
In independent assortment, different gene variants or 'alleles' are independently and randomly assorted into daughter cells, which allows genetic recombination.
In eukaryotic organisms, DNA is associated with histone proteins in order to form nucleosomes, which arrange in higher organization structures called chromatin fibers.
Subsequently, chromatin fibers condense to form structures called chromosomes.
A triploid organism (3n) contains three sets of homo-logous chromosomes, each one containing one allele for a given locus.
In conclusion, the process involved in genetic recombination is INDEPENDENT ASSORTMENT. The correct order from smallest to largest is DNA, nucleosomes, chromatin, chromosomes. In a triploid organism, there are 3 ALLELES for each gene per cell.
Learn more in:
https://brainly.com/question/10118000
If air pollution causes the rain that falls on this pond to become much more acidic after two years how will this acidity
affect the living things in this pond?
There will be more plants and animals because the acid will kill most of the disease causing microorganisms
There will be more plants and animals because the acid is a source of food,
There will be fewer plants and animals because many of them cannot survive in water with high acidity,
D There will fewer plants and animals because the acid will dissolve many of them,
Answer:
the guy above me is correct
Explanation:
I know this isn't a explanation so I don't really know why I am putting it under the explanation category but I am really sorry if it is wrong
‼️‼️‼️
PLEASE HELP WILL GIVE BRIANLIEST :))
Answer:
J SHAPED CURVE GIRL
Explanation:
HOPE THAT HELPS MUAH!
Why can't polar bears survive on berries or eggs?
Answer:
Polar bears that are forced to live on land due to melting ice face lean times in most of the Arctic. Food found on land, such as berries and eggs, lack the high fat content and calories of the bears' preferred prey.
Explanation:
rashid is conducting a seminar on the importance of coral reefs which point should he include
Answer:
Protect coastlines from storms, erosion and provide habitat.
Explanation:
Coral reefs protect coastlines from storms and erosion as well as provide a habitat for thousands of aquatic animals. These points rashid must include in his seminar. Coral reefs are very important for the marine ecosystem because it can save the soil from erosion and decreases the intensity of storms by acting just like barrier. It provides food as well as living place for many organisms so these point are very important to be included in the seminar.
Answer:
that corals provide economic assistance to coastal populations through fisheries
Explanation:
Which of these does not represent a direct transfer of carbon
1.Air to trees
2.Giraffe to tree
3.Tree to Giraffe
Which of the following does NOT belong
how do all the dna structures work together is it like a machine
its like a twisted ladder or a double helix
how stuff works dot com
Explanation: Yes, It is like a machine only a person sits in a chair and they have to tell the truth while the worker asks the person questions and they have thing wrapped around there arm to tell if there telling the truth or lying so yes it is like a machine.
I AM GIVING OUT BRAINLIEST
Answer:
1.sun 2. consumers
Explanation:
Question 5 of 10
As of the year 2000, the human population was approximately
Answer:
A. 6 billion
Explanation:
The full question is:
As of the year 2000, the human population was approximately _______.
A. 6 billionB. 3 billionC. 1 billionD. 10 billionHelp with these questionsss pleasee
Answer:
21. Troposphere
22. Exosphere
23. Troposphere
24. Mesosphere
25. Crust
26. D
27. B
28. A
29. Sun
30. D
Explanation:
Troposphere is the layer of atmosphere that is present near to the earth surface whereas exosphere is the layer of atmosphere that is present farthest from the earth surface. Troposphere is the layer where weather of the earth is present. The mesosphere is the layer of the atmosphere that protects the Earth from meteoroids. Crust is the part of the earth on which we walk. oceanic crust and continental crust are the two types of crust. Mantle is the layer in which convection currents occurs. Convection currents refers to the rising of hot magma and sinking of cool magma. Sun is the source of energy and all energy comes to the earth from sun. Transitional boundary is not a types of plate boundaries.
Como se chama a transferencia de enrgia termica flui de um corpo com maior temperatura quando ao outro de menor temperatura quando ha diferença de temperatura entre ambos
Answer:
Conduction.
Explanation:
Conduction is the process in which heat energy is transferred from the hotter body towards colder body because of temperature difference between two bodies. Conduction occurs only due to physical contact between two bodies. In the conduction process, the thermal energy flows from a body with a higher temperature to the other body having lower temperature until both bodies having same temperature.
WILL GIVE BRAINLIEST
Which of the following has the form of small elongated particles, some of which are believed to be carcinogenic and
dangerous to human health?
A) methane
B) mold
C) formaldehyde
D) ozone depleting substances
E) asbestos
Answer:
the answer is actually e, asbestos :)
Explanation:
e2021
Can you please help me with this...
Answer:
A. Asexual
Explanation:
I majored in Biology