2000 N force cause an elevator to accelerate at 2 m/s2. What is the mass of the elevator?

Answers

Answer 1

Answer:

U can download Socratic it’s an app and take a pic of the question :)

Explanation:


Related Questions

based on questions 6 , 7 or 8 what happens to the voltage required in a circuit as the resistance decreases ? increases ?

Answers

Answer:

As the resistance decreases the Voltage Increases

Explanation:

20 POINTS!!!
PLEASE HELP
lmk if you can’t read!

Answers

Answer:

1. Flinch eats the Sun's energy.

2. Fox

3. 6

4. The snake is a secondary predator, while the flinch is a producer.

5. The fox and (bird next to fox name)

Explanation:

NO LINKS! NO PDF'S! NO FILES! JUST ANSWER!!! PLEASE HELP ASAP

Answers

(1. Physical adaptation (2. Behavioral ( 3. physical adaptation (4.behavioral (5. physical (6. behavioral (7. physical (8. behavioral (9. physical (10. behavioral (11. behavioral (12. behavioral

PLEASE HELP! WILL GIVE BRAINLIEST. Describe the contribution of photosynthesis and cellular respiration to the exchange of carbon between the atmosphere and the biosphere.

Answers

Cellular respiration and photosynthesis are essential to the carbon cycle because cellular respiration involves the intake of oxygen o2 and the exhale of carbon-dioxide co2 into the atmosphere. Where photosynthesis uses the carbon dioxide and water to create oxygen and sugars through energy to repeat the cycle. Respiration in general is a process where carbohydrates are turned into dihydrogen monoxide or water and co2(carbon dioxide). Living organisms together throughout the biosphere and atmosphere work together to continue this because carbon itself is an organic substance.

Answer:

Explanation:   Cellular respiration and photosynthesis are important parts of the carbon cycle. The carbon cycle is the pathways through which carbon is recycled in the biosphere. While cellular respiration releases carbon dioxide into the environment, photosynthesis pulls carbon dioxide out of the atmosphere.

The biological selection of a particular allele for a trait to be passed to offspring has nothing do with the selection of the allele for another trait. Which of the following supports this statement?​

Answers

Answer:

1

Explanation:

Which of the following statements is true. *
10 points
Sperm : Produced in ovaries Eggs: Produced in testes
Sperm: Produced in testes Eggs: Produced in ovaries

Answers

Answer:

sperm produced in testes, Eggs produced in ovaries

1. The process of translation is responsible for producing which type of molecule?

A. Polypeptide
B. RNA strand
C. DNA strand
D. New gene


Answers

rna strand im pretty sure

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries

As fast as you can, name the planets in order from the sun.

Answers

Answer:

Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus, Neptune

Explanation:

Thenks and mark me brainliest :))

Answer: mercury, Venus, earth mars, Jupiter, Saturn, Uranus, Neptune,

and 15 years ago Pluto

Explanation: i should get extra for saying pluto

a scientific ________ is based on the results of numerous experiments.

Answers

Answer:theor

Explanation:

b

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

Identify and explain one aspect of your public speaking skills that you can improve. How can you work to improve this aspect?

Answers

Answer:

improve not moving around when you talk

Explanation:

being loud and projecting your voice is a hug part of public speaking

what is the botanical name of milk​

Answers

Answer:

Milk of magnesium's scientific name is magnesium hydroxide, and the scientific name for milk of sulfur is precipitated sulfur.

The botanical name of milk is not applicable, as it is not a plant or a plant product. Botanical name is the scientific name given to plants, fungus and algae.

Milk is a nutrient-rich fluid produced by mammals. It is frequently consumed as a source of nutrients and is renowned for having a lot of calcium. Water, lipids, proteins, carbs, vitamins, and minerals are all present in milk in complicated proportions.

There is no particular botanical name for milk in the field of biology, which is the study of plants and their categorization. Different plant species are identified and categorized using botanical names.

Milk lacks a botanical name since it is a byproduct of animals, not plants.

Learn more about botanical names here:

https://brainly.com/question/20532715

#SPJ6

An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?

Answers

Answer:

True

Explanation:

As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.

Hence, the given statement is true

Humans depend on the biodiversity of living things for all of the
following EXCEPT

A. Weather
B. Food
C.medicine
D.shelter

Answers

The answer to your question is c!
answer should be A
hope this helps :)

Cuando se excita una neurona con estímulos de intensidad creciente se obtiene, a partir del umbral, la misma respuesta eléctrica. En esta situación se pone de manifiesto la característica de: *
A) ley del todo o nada.
B) período refractario relativo.
C) período refractario absoluto.
D) excitabilidad.
E) umbral de excitación.

Answers

Answer:

d) excitabilidad

Explanation:

creo que seria esa no lo sé

no se mucho de eso

me dices si sale buena o mala

Find a recent article that is centered around life science and give a report about it.....answer these 3 questions: 1) How is this article related to life science? 2) What interesting information did you read about in this article? 3) Why would this article be important for others to read?

Answers

I think the answer is A but I’m not sure have a great day buddy let me know if I can help with anything else

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

¿Cual es la importancia biológica de los estímulos umbrales?

Answers

Answer:

En electrofisiología, el potencial umbral es el nivel crítico al que debe despolarizarse un potencial de membrana para iniciar un potencial de acción.

Explanation:

En neurociencia, los potenciales de umbral son necesarios para regular y propagar la señalización tanto en el sistema nervioso central (SNC) como en el sistema nervioso periférico (SNP).

Espero que esto ayude :))

PLEASE HELP JUST MATCH THEM UP

BRAINIEST ANSWER!!!

Answers

Explanation:

71% of the Earth----All of water on Earth

97%of water on Earth----- Salt water

77%of the freshwater on Earth------Frozen in Glaciers

22% of fresh water on Earth----- water Underground


Which of the following is a way in which the atmosphere does NOT
interact with the hydrosphere? *
A). Decreasing the salinity of oceans from increased temperatures causing glacial
melting.
B). Developing hurricanes over warm ocean currents.
C).Increasing the amount of water evaporation from oceans and global temperatures
rise.
D). Gases moving sediment from hill tops

Answers

The correct answer is d. Please give me brainlest let me know if it’s correct or not okay thanks bye

Examine the photograph. Identify at least three natural resources being used. Describe where each natural resource came from.

Answers

Answer:

Water- from water comes from a variety of sources, including many of the same sources as tap water.

Leather- from rawhide and skins. The most common raw material is cattle hide.

plastic- from cellulose, coal, natural gas, salt and crude oil through a polymerisation or polycondensation process

Explanation:

<3

what're the two body systems opossums use to fake their death?

Answers

Apparent death, colloquially known as playing dead, feigning death, or playing possum, is a behavior in which animals take on the appearance of being dead. This form of animal deception is an adaptive behavior also known as tonic immobility or thanatosis. Apparent death can be used as a defense mechanism or as a form of aggressive mimicry, and occurs in a wide range of animals.

When induced by humans, the state is sometimes colloquially known as animal hypnosis. According to Gilman et al.,[1] the investigation of "animal hypnosis" dates back to the year 1646 in a report by Athanasius Kircher.

Opossums do not virtually play lifeless whilst they are threatened. Instead, they involuntarily input a catatonic kingdom.

Opossums, as they're generally called, are much more likely to run the alternative way, uncover their tooth, and growl in risky situations.

Playing dead is an involuntary reaction at the a part of the opossum. The strain of the war of words going through the opossum reasons him to enter surprise. This surprise induces a comatose kingdom that may remain for forty minutes.

Why ringtail Opossums don't play dead.

No, ringtail Opossums they do not, they make a sound, you could concentrate on it on the subsequent post: Strange Australian Back Garden Beastie Sounds.

Therefore it is clear that they play dead by unover their tooth and growling in risky situations.

To learn more about opossums refer to the link;

https://brainly.com/question/1056658

Over time, data that support the successful evolution of a species would include observations that describe

Answers

More body cells and more genetic changes happening

What are the products of photosynthesis?

Answers

Answer:

The reactants for photosynthesis are light energy, water, carbon dioxide and chlorophyll, while the products are glucose (sugar), oxygen and water.

Explanation:

This is where I got the information:

sciencing.com/reactants-products-equation-photosynthesis-8460990.html

I hope this helps!

Apply what you know about lipids to explain why the cuticle helps prevent water loss in plants. Compare it to what humans do.

Answers

Answer:

Explanation:

Waxy cuticle is a white powdery substance that is insoluble, it is found usually on the surface of stem or leave and it prevent excessive loss of water through transpiration.

It is an adaptive mechanism used in dry areas or desert to help plants retain water that is needed for their growth by reducing amount of water loss through transpiration.

Cactus is an example of plant with cuticle that thrive well in dry areas

To review, what are the three main types of symbiotic relationships?
A. mutualism. commensalism, and parasitism

B. mutualism, community, practice

C. membership, commensalism, property

Answers

Answer:

A

Explanation:

The three main types of symbiotic relationships are mutualism, commensalism and parasitism

is the A is the one that has the most logic to your question
Other Questions
Elijah estimates that 80% of the email he receives could be classified as junk. To predict how many junk mail messages he might receive out of the next 50 emails, he places 8 red and 2 blue marbles in a bag. He draws one marble at random from the bag and records its color before replacing it. He records the following results. BR RR RIRIR RR B BRRRR RR RBR RRB BR How can Elljah use the results of his simulation to predict the number of junk mail messages he will receive in the next 50 mails?PLZ HELP The box plot below represents some data set. What percentage of the data values are between 20 and 55? Was Joseph A. Califano Jr. a liberal or conservative? How many protons are in an atom of phosphorus Reflexive or Not Reflexive: Write R or NR to determine whether or not it is reflexive. Te lavas las manos, Nos acostamos a las nueve. Ellos se despiertan a las siete. T levantas a tu hermana. Yo me cepillo los dientes. Classify the object with the given side lengths as acute, obtuse, right, or not a triangle.16, 21, 28RightAcuteObtuseNot a triangle 5 A Punnett square is shown below. The domintrait is represented by R. The recessive trait isrepresented by r.What percentage of the offspring will mostlikely show the dominant trait?(1 25%(3) 75%(2) 50%(4) 100% Find the range and the midrange for the following data set: 7.25, 6.75, 6, 7.5, 7, 7, 7, 7.5, 6, 8.5, 8.5, 6.5, 7, 5.5, 8.5, 7.25, 7.25 a Range = 7.25, Midrange = 6.25 b Range = 3, Midrange = 7 c Range = 5.75, Midrange = 6.5 d Range = 8, Midrange = 7.25 What happened during Kristallnacht?A. Many Jews were taken to concentration camps.B. Hitler proposed his "final solution to the Jewish question."C. Many Jews fled Germany for refuge in Britain, France, and the the United States.D. German troops destroyed synagogues and Jewish businesses.(NO LINKS PLEASE) Draw a scale diagram of 15 mm scale factor of 8 pleaseee help where was Black Pink Rose born Simplify 17.6L:20800 ml If a driver drives at a constant rate of 38 miles per hour, how long would it take the driver to drive 323 miles? Reading your papers aloud to yourself or someone else is what effective method?A. Checking for coherenceB. ProofreadingC. Checking sentence structureD.All of the above Read Part One of Article B on sea otters.If you have ever watched sea otters swim and play at your local zoo, you know they are extraordinary animals. But did you know they are under threat of extinction? That means no more sea otters in the wild and fewer in captivity. Sea otters have been on the Endangered Species List for over 45 years, but there are actions humans can take to protect them.The Fur TradeIn the 1800s, sea otters were hunted for their fur. The fur trade between North America and Europe was booming, and sea otter fur was a popular option because of its thickness. By the mid-20th century, sea otters had been hunted to near extinction. Only 1,0002,000 sea otters were believed to be living in the wild in 1929. Many people thought the species would soon become extinct. However, due to conservation efforts during the second half of the 20th century, sea otter populations recovered. The strengthening of the numbers of sea otters in the wild is often considered to be one of the greatest successes in marine conservation.Despite their comeback, sea otters are sadly still an endangered species. This is due to predators and human impact on the sea otter's habitat.PredatorsSea otters are threatened by other animals in the water and on land. Killer whales are one of the sea otter's main predators now that the seal and sea lion populations are declining. Sharks, sea lions, and eagles also pluck sea otters from the water while bears and coyotes will hunt them on land. Sea otters use their intelligence to outsmart some of their predators. They also use their sharp teeth to protect themselves.What is the author's point of view on the reason the sea otter population recovered?Sea otters learned to eat a more varied diet, saving themselves from extinction.More people started owning sea otters as pets, which increased their number.Laws were passed to shorten the number of months in sea otter hunting season.Conservation efforts in the last half of the twentieth century saved sea otters. plzzzzzz help for a brianly Which correctly compares the medians and the measures of variability of the data in the box plots? Select threechoicesThe difference in the medians is about 1.5 hours,The range for both middle school students and elementary school students is 6 hours,The interquartile range for middle school students is 5, and the interquartile range for elementary school students3Both sets of data have the same maximum and minimum valuesThe medians for the two sets of data are the same, how does the structure of the leaf allow it fulfil the requirements for gas exchange surface?(pls don't put it in a file or pls no link) :) what is the difference between slope and a common ratio? Inferring is a strategy to only be used on non-fiction texts. Please select the best answer from the choices provided T F