14.
appears considerably larger at the
horizon than it does overhead is merely an
optical illusion.
(A) The Moon
(B) That the Moon
(C) When the Moon
(D) The Moon which

Answers

Answer 1

Answer:

a

Explanation:

i dont understand

Answer 2
It’s option A, the moon

Related Questions

How does Tom's death link to the title of the novel?

Answers

Answer:

Tom's death is linked to the title of the novel because just how mockingbirds do nothing but sing, Tom Robinson did nothing wrong and only helped Mayella. ... The people of Maycomb seem to move on fairly over the death of Tom Robinson.

Explanation:

descriptive writing about a day at the ocean​

Answers

Answer:

Here's one. Hope it helps.

Explanation:

The waves were indeed gentle today, slowly ebbing towards the shore and nipping at my feet, sending some of its contents in the form of crabs, seashells and seaweed. But I hadn't a single care in the world.

I wiggled my toes, letting them dig further into the sand and create a calming room of sand, cool from the water and warmth from the temporary depth. Today was supposed to be a good day, I wasn't even supposed to be at the beach. Truth is I wasn't a huge fan of water. I drowned when I was sick and never got over the trauma.

But I didn't really have a choice, I remembered as I looked beside me to confirm the presence of Lionel, my long lost brother. He was only two years younger than I was, and he went missing over a year ago. I was only driving past when my eyes were drawn to his lonely figure among the crest of the waves.

So here I was, not even having the courage to utter a single word in fear that he was only a mirage, that he would dissipate as soon as I made a sound.

And even if I did make a sound, what would it be? Would I just ask him where he was? Would I yell? Hug him? Kiss him?

He didn't seem in a position to answer me anyway with his dark, sunken eyes and bony, wispy fingers that clutched the loose sand in a death grip.

Without a single form of warning, he unleashed a deathly scream...

When writing a story, do you italicize the names of brands such as Disney+?

Answers

Answer:

Nope

Explanation:

You need to capitalize it, and you can't go wrong with adding them into the resources viewed section, but they do not need to be capitalized. Some people do capitalize, but that is optional, as you will notice that people do not italicize it often (or more often) than it is italicized.

What is are the most notable things about early settler literature?

Answers

Answer:

The difficulties of establishing in the new environment, the relationship with the natives, religiosity and colonialism are the most notable subjects in the literature of the first colonizers.

Explanation:

Literature is strongly influenced by the historical moment in which it is being established. This includes the literature written by the first colonized in North America, since through their texts, we can perceive a strong religiosity, mainly in relation to Puritanism, as a way to withstand the physical difficulties that the American environment presented to the pioneers. In addition, this literature presents the pillars of colonialism and the controversial relationship between Europeans and Native Americans.

Was Ancient Athens truly
democratic?
(Please use the document to answer the question above)
I give out brainliest!!!

Answers

Answer:

according to the document ancient athens was not truly democratic as the votes of ALL citizens were not counted.

Is it important to wear uniform for university students? if agree or disagree prove your answers within 250-300 words

Answers

Explanation:

In my opinion, the use of uniforms for university students is not important. The central function of a uniform is the identification of its students, which can be important for high school and elementary students, for their own safety, since as they are minors this is a greater support that the student belongs to a school.

University students, on the other hand, should not have the obligation to wear a uniform, this should be a right of choice, since it can influence a young person's individuality and their right to express themselves.

Most college students also go to work and then classes in college, and they usually need to wear uniforms in their jobs, so there is also the question of time, which would be a negative aspect of mandatory uniform use.

What is the purpose of including reasons in your report?

They convince your readers that you know what you’re talking about.
They make you sound smarter than you actually are.
They help your readers visualize the information you provide.

Answers

Answer: They convince your readers that you know what you’re talking about.

Explanation:

The purpose of including reasons in the report is to convince the readers that they know what they are talking about. Thus, the correct option is A.

What is a report?

A report is a document which presents the information in an organized format for a specific audience and a specific purpose. Although the summaries of reports may be delivered orally, the complete reports are almost always present in the form of written documents.

To analyze the problems and predict practical alternatives is the primary purpose of a report. Reports are used to communicate information which has been compiled as a result of the research and the analysis of data and of the issues. The reasons are included in the report to convince the readers that they know what they are talking about in the report.

Therefore, the correct option is A.

Learn more about Report here:

https://brainly.com/question/14969693

#SPJ3

Help me please!!!!!!!!!!!!!!!!!

Answers

Answer:

tbh i dont know this but goodluck with the 2nd person who answeres

Explanation:

oh don't know the full story so can't help

Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive?
A.
There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination.
B.
Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her.
C.
Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom.
D.
The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship.

Answers

Answer:

I think D "The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship." is the most descriptive I was going to say C but ive realize that D was more descriptive.

Explanation:

what is the process required to develop an essay?
A. You must check you final draft for spelling and grammar errors.
B. You must make sure someone has written on a similar topic before so you have to model on which to base your own writing.
C. You must provide details to support your thesis.
D. You must make and support an argument in an effort to convince your readers of something.

Answers

Answer:

A

Explanation :

So that you can fix the spelling errors you have and get better marks

True or False: If you are good at finding and keeping jobs, you have high employability.

Answers

Answer:

True

Explanation:

If you look for the definition of employability, this is what you will find:

(the quality of being suitable for paid work.)

In a sentence, this is an example:

"A new study ranked the world's top universities based on the employability of their graduates."

I hope this helps you!

Good Luck!

Answer:

True

Explanation:

I took the test

People have the right to _____. Select 3 options.

associate with whomever they choose

have control over their personal information

not have what they think and feel revealed

be told what to believe and what to buy

be tracked, monitored, and identified

Answers

People have the right to have control over their personal information. Thus, option C is correct.

What is right?

A right is a possession that someone has that, in the opinion of others, ought to not be implemented away. It is a restriction on what a person may do or possess. A privilege is someone that must be acquired, whereas a right is someone that is inherent.

A citizen's right to decide how their private data is gathered and utilized is known as data privacy. Privacy is a component of data protection. This is due to the fact that preventing data about users' privacy requires first securing sensitive details as well as user data.

Personal information encloses a comprehensive coverage of knowledge , or an opinion, that could place a person. Therefore, option C is correct.

Learn more about right, here:

https://brainly.com/question/10710431

#SPJ2

In the context of the poem what contributes to the poems arrest? What biases do you think law enforcement falls victim to in real life

Answers

Answer and Explanation:

This question is about "Poem Resisting Arrest"

According to the context of the poem, we can say that the poem was arrested for being a questioner, provoking reflection and questioning situations, concepts and behaviors. In this context, we can infer that the application of the law becomes the victim in real life for having to to imprison that which instigates human feelings, such as the poem, causing the arrest of that which can bring about good, even if in an uncomfortable and intriguing way.

help asap just give the answer​

Answers

Answer:

4 a

5 b

6 c

7 a

8 a

9 b

10 c

this are the answers thanks

The ones I seen wrong with the first person that answered is 7&8 is a personification 9 is a simile 10 is alliteration I’m not 100% postive but I think that’s right I may have got one wrong but have a great day and I hope I helped :]

______ tail feathers are black with while wing patches.

A.It's
B.Its
C.its
D.it's

______ interesting to learn about the acorn woodpecker.

A.it's.
B.its.
C.It's.
D.It's​

Answers

Answer:

#1 is B

#2 is D

Explanation:

It's = It is/It has and Its = [possessive it]. A fun way to remember this is to think of the apostrophe ( ' ) as an I. Hope this was helpful to you!

Answer:

1) A. It's. is the answer for first one as it shows possession.

2) in second the answer is " It's " as it is the abbreviation of IT IS.

I need the answers to the common lit why we try, try again assessment.

Answers

I can only find this source that has pdf’s on the book try to see if it has the answer


Search up HOME / COLLECTIONS LESSONS FROM FAILURE WHY WE TRY TRY AGAIN COMMONLIT ANSWERS

And multiple pdf will pop up maybe try one of those

Select the correct answer from each drop-down menu.
Complete the sentences to identify the types of research sources Sofia should use.
Sofia works at the city manager's office. She's conducting research on the benefits of providing free, citywide wireless internet access for all citizens. As a primary source of research, she should use __________ . She should also look up _________ as a secondary source for her research.

First blank:As a primary source of research, she should use __________ .

First blank answers:
A)An article from the local newspaper
B)A survey of the resindent's opinions
C)A website about internet connectivity

Second blank:She should also look up _________ as a secondary source for her research.

Second blank answers:
A)Internal reports on internet hotspots in the city
B)Interviews with local internet service providers
C)E-books about case studies of internet initiatives

Answers

Answer:

First blank- B) A survey of the resident's opinions

Second black- A) Internal reports on internet hotspots in the city

Explanation:

not for sure

Plz help ASAP

Making the Most of Mucus
Just the name itself will make you giggle. It's a great word that conjures visions of slime and
unpleasantness. It is perhaps the most annoying part of having a cold or allergies. Mucus, however,
plays a very important role in defense of our bodies and our health. In fact, it's high time mucus got
a lot more respect.
First, there are some amazing facts about mucus that are worthy of respect. Humans produce
about a liter of mucus every day, whether they are sick or not. Bony fish and some invertebrates
(snails or slugs) also have mucus cells on the outside of their body. This external mucus creates a
protective coating that prevents predators' toxins from doing harm. Humans produce mucus to
protect our stomachs, our lungs, and several other systems.
We tend to not like mucus because it is a considered a symptom or sign that something is wrong.
We usually only see it when we are sick, and so we tend to dislike it. According to Michael M.
Johns, III, MD, however, "mucus is incredibly important for our bodies." Johns, an assistant
professor at Emory University, calls mucus "the oil in the engine" of our bodies. Without mucus, our
engines, or bodies, would freeze up and stop working properly.
engines, or bodies, would freeze up and stop WURING prope
Furthermore, mucus is not just the nasty gunk you see when you are sick. It lines the tissues in
your mouth, your nose, throat, and lungs. It also is crucial in protecting your digestive system.
Mucus puts a protective coating over the surfaces of these tissues, keeping them moist. Most of
the time we don't notice mucus is making our lives better. It does its job quietly, making everything
run smoothly, keeping our inner tissues soft and flexible enough to fight off invaders.
Occasionally, though our mucus-making membranes go into overdrive. If you eat a hot pepper, your
mucus membranes in your mouth and throat start producing extra mucus to protect you. If you
come into contact with pollen, you may get a runny nose and start sneezing and coughing. When
these things happen, your mucus systems start making more fluids to wash away the irritating
particles. Mucus also has some antibodies that increase our ability to fight off bacteria and viruses.
It's hard to appreciate what is essentially slime, but we have mucus for some very good reasons. It
helps to keep us healthy and lets us know when our bodies are under attack. We would be wise to
respect what our bodies do to keep us safe. So the next time you find yourself reaching for a tissue,
remember mucus is your friend and ally.

What's in a Name?
Mucus is a great word, not only because it gives name to an important bodily function, but also
because it is one of those words that simultaneously makes you feel grossed-out and giggly.
Other words for this powerfully important hurnan-health tool include slime and phlegm. Slang
words for mucus include boogers and snot. All of these words have the same giggle-power,
simply from the combination of consonants and vowels. By the way, mucus is an old word; it's
been around since the mid-1600s and has roots back to Latin (mucere, to be moldy or musty)
and Greek (myxa, mucus). While you may assume that words like snot and boogers are
relatively new slang terms, they are not. Snot dates to 1560 and comes from an Old English
word, gesnot, and has the same root as the word snout. The word booger is not quite as old but
has been in use since the 1890s.

Which would be considered a supporting point for the main idea of “making the most of mucus”?

A. The word mucus is silly.

B. mucus protects the digestive system.

C. Hot peppers increase mucus production.

D. Mucus is a friend to human bodies.

Answers

Answer:

D. Mucus is a friend to human bodies

Explanation:

Hope this helps.

Sorry if I am wrong.

shawtys been simping for so long..

Answers

Answer:

you rocking w the simping ?

Explanation:

ur down bad

Sis can u get on snap cuz i miss u!!!!!!!!! hope ur doing good <3

Question not relevant
What kind of fashion/ makeup trends do girls have in western countries? I wanna be like a foreign girl >< please share with me before I travel to US.\/ :)

Answers

Answer:

casual

we usually wear sweats and a short sleeve tee or ripped blue jeans

Blue jeans and a hoodie or blue jeans and a crop top.

In at least one hundred words, analyze how Hawthorne develops the theme of the pervasiveness of sin in "Young
Goodman Brown."

Answers

Answer:

잘 봐 넌 그 꼴 나지

우린 탁 쏴 마치 콜라지

너의 각막 깜짝 놀라지

꽤 꽤 폼나지 포 포 폼나지

Answer:

         In Nathaniel Hawthorne's story by the title "Young Goodman Brown," the author develops the theme of the pervasiveness of sin by describing in detail the consequences that will follow if one were to commit a sin of any nature. Even if Goodman Brown, the main character of the story, is not able to see these sins being committed, he claimed to know when the people would sin. The people, however, knew that he was lying, so they continued to sin thinking that he did not and could not know that he knew about their sins. Goodman, on the other hand, did in fact know of their sins because he was told of them by the Devil himself. He was disgusted with the sins that they committed under the belief that Goodman had no clue what they were doing.

Explanation:

Hello :) Please rewrite this in your own words! Have a good day <3

complete question please i need answer​

Answers

Answer:

a) The speaker of this story is the president of India.

b) The facts that support India as a developed nation is “We have 10 percent growth rate in most areas. Our achievements are being globally recognized.”

c) We couldn’t think ourselves to be a developed nation because we lack confidence.

d) India is required to see themselves as a developed nation in order to be globally recognized.

Explanation:

Read the document "Brown University: Protests and Demonstration Guidelines," Why is obstructing the exchange of ideas or the movement of people during protests prohibited by these guidelines?

Answers

Answer:

Such obstructions are a form of censorship that also interfere with the right of others.

Explanation:

The policy guiding protests and demonstrations in Brown University mentioned that protests were accepted as a form of expression in the community. However, when this protest prevents others from expressing themselves, that would be a trampling of their rights and this is frowned upon by the University.

So, in a bid to express themselves, others should not be censored, that is, prevented from airing their own views. Interruptions of the speech of others were also viewed as an obstruction of their freedom of expression.

Read the excerpt from "Superhero 101: A Dog's Day."

Liam and Tia looked toward the pet store as the four friends dodged into an alleyway, trying not to look too conspicuous. Casper was obviously in disguise himself with his dyed brown hair and beard.

Which phrase in the excerpt helps the reader know the meaning of conspicuous?


with his dyed brown hair and beard

dodged into an alleyway

pet store as the four friends

looked toward the pet store

Answers

Answer:

B: dodged into an alleyway

Explanation:

The phrase in the excerpt helps the reader know the meaning of conspicuous is with his dyed brown hair and beard. Thus, option A is correct.

What is Flashback?

Flashback is designated as the technique by which the author offers detail about the past event so that the readers are able to comprehend it more precisely and clearly.

In the given excerpt, the flashback is employed to educate or aware the audience about the past event when Trace along with his friends uses their extraordinary skills to develop the toxin and overtake the world.

Therefore, The phrase in the excerpt helps the reader know the meaning of conspicuous is with his dyed brown hair and beard. Thus, option A is correct.

Learn more about "Flashback" here:

brainly.com/question/16645020

#SPJ3

can someone help me please i am struggling very badly with this question.


What elements for a clause?
A. A subject, a predicate, and a verb
B. two subject and a predicate
C. A subject and two predicates
D. A subject and a predicate

Answers

Answer:

A. a subject, a predicate, and a verb ( not sure i also suck at this things )

Answer:

A. SUbject predicate and verb!

Explanation:

ARMYYY BTS DIDN'T ET GRAMMYS

WHYYYY T-T

In autumn how does the poet present the effects of the season of autumn

Answers

Sorry wanna pointa

Answer:

There correct

Explanation:

i need some quotes with a tragic fate :) ​

Answers

Answer:

Without beauty a girl is unhappy because she has missed her chance to be loved. People do not jeer at her, they are not cruel to her, but it is as if she were invisible, no eyes follow her as she walks. People feel uncomfortable when they are with her. They find it easier to ignore her. A girl who is exceptionally beautiful, on the other hand, who has something which too far surpasses the customary seductive freshness of adolescence, appears somehow unreal. Great beauty seems invariably to portend some tragic fate.

Explanation:

Why did the Nazis have Death Marches during the final months of the war?

Answers

28282822929928282282

Story: THE WAR OF THE WALL (write a short 4 paragraph essay)

In the context of the text, why is the wall important to the community? How does the mural that the woman paints help further unite the community? Describe a time when your community was brought together by a significant event. What are the things that bring your community together?

Answers

Answer:

How does the mural

that the woman paints help further unite the community?

Explanation:

PLEASE HELP ME ASAP!!

True or False; The tople sentence belongs in the first sentence of each body
paragraph.

Answers

Answer:

true

Explanation:

I believe you mean topic sentence, if so it would be true :)

Other Questions
Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks. If 2 cups makes 6 servings, how much makes 2 servings? shawtys been simping for so long.. do you think hunter-gatherers are still around today? what makes you think that? Hi, I am very stuck on questions 17 and 18. Can someone help please? Thanks In which quadrant does the point with c ordinate (4, -3) lie? Which student has the greater median test score? I have to study for a test. It's for data management. Does anyone have tips? (Grade 7) PLEASE HELP ME WITH ALGEBRA! THANK YOU Explain how Japan took control of Manchuria. This is worth 16 points if you show work you will get the Brainliest answer if your unable to show work type it for your explanation plz ( no links ) How was the celebration of St. Patrick's Day connected to Ireland's struggle for nationhood? Plzz Help due today!!!