10. What adaptations allow polar bears to walk on ice without slipping?
O Only Pilli
O Only long claws
Pilli and long claws
Papillae and long claws

Answers

Answer 1
the answer is papillae and long claws

Related Questions

Which of the following statements is true. *
10 points
Sperm : Produced in ovaries Eggs: Produced in testes
Sperm: Produced in testes Eggs: Produced in ovaries

Answers

Answer:

sperm produced in testes, Eggs produced in ovaries

Which of the following is evidence that cells no longer respond to external factors and may have turned cancerous?

A. New cells replace old or damaged cells.
B. Cell clumps form, crowding existing cells.
C. Dead cells are shed at a more rapid rate.
D. Dormant cells re-enter an active cell cycle.

Answers

Answer:

option C will be the correct answer

Dead cells are shed at a more rapid rate is evidence that cells no longer respond to external factors and may have turned cancerous.

What are the cancer cells?

Cancer cells are defined as cells which divide continually, forming solid tumors or flooding the blood with abnormal cells. Cell division is a normal process used by the body for growth and repair.

Sometimes this orderly process breaks down, and abnormal or damaged cells grow and multiply when they shouldn’t. These cells may form tumors, which are lumps of tissue.

For more information regarding cancer cells, visit:

https://brainly.com/question/373177

#SPJ2

what're the two body systems opossums use to fake their death?

Answers

Apparent death, colloquially known as playing dead, feigning death, or playing possum, is a behavior in which animals take on the appearance of being dead. This form of animal deception is an adaptive behavior also known as tonic immobility or thanatosis. Apparent death can be used as a defense mechanism or as a form of aggressive mimicry, and occurs in a wide range of animals.

When induced by humans, the state is sometimes colloquially known as animal hypnosis. According to Gilman et al.,[1] the investigation of "animal hypnosis" dates back to the year 1646 in a report by Athanasius Kircher.

Opossums do not virtually play lifeless whilst they are threatened. Instead, they involuntarily input a catatonic kingdom.

Opossums, as they're generally called, are much more likely to run the alternative way, uncover their tooth, and growl in risky situations.

Playing dead is an involuntary reaction at the a part of the opossum. The strain of the war of words going through the opossum reasons him to enter surprise. This surprise induces a comatose kingdom that may remain for forty minutes.

Why ringtail Opossums don't play dead.

No, ringtail Opossums they do not, they make a sound, you could concentrate on it on the subsequent post: Strange Australian Back Garden Beastie Sounds.

Therefore it is clear that they play dead by unover their tooth and growling in risky situations.

To learn more about opossums refer to the link;

https://brainly.com/question/1056658

Which statement describes the proper procedure for identifying an organism by using a dichotomous key?

Answers

Explanation:

A dichotomous key is a tool that allows the user to determine the identity of items in the natural world, such as trees, wildflowers, mammals, reptiles, rocks, and fish. Keys consist of a series of choices that lead the user to the correct name of a given item. "Dichotomous" means "divided into two parts".

20 POINTS!!!
PLEASE HELP
lmk if you can’t read!

Answers

Answer:

1. Flinch eats the Sun's energy.

2. Fox

3. 6

4. The snake is a secondary predator, while the flinch is a producer.

5. The fox and (bird next to fox name)

Explanation:

Over time, data that support the successful evolution of a species would include observations that describe

Answers

More body cells and more genetic changes happening

Examine the photograph. Identify at least three natural resources being used. Describe where each natural resource came from.

Answers

Answer:

Water- from water comes from a variety of sources, including many of the same sources as tap water.

Leather- from rawhide and skins. The most common raw material is cattle hide.

plastic- from cellulose, coal, natural gas, salt and crude oil through a polymerisation or polycondensation process

Explanation:

<3

Humans depend on the biodiversity of living things for all of the
following EXCEPT

A. Weather
B. Food
C.medicine
D.shelter

Answers

The answer to your question is c!
answer should be A
hope this helps :)

List one way that mitosis and meiosis are similar
and 1 way they are different.

Answers

The difference they have is mitosis produces two daughter cells with the same number of chromosomes as a parent cells. How they are alike is they are two type of cell divisions and associated with cytokinesis.

PLEASE HELP JUST MATCH THEM UP

BRAINIEST ANSWER!!!

Answers

Explanation:

71% of the Earth----All of water on Earth

97%of water on Earth----- Salt water

77%of the freshwater on Earth------Frozen in Glaciers

22% of fresh water on Earth----- water Underground

What is the "body" of a plant called?

Answers

Answer:

it's called a tissue right?

.A jogger with a mass of 81.6 kg is moving at 2.2 m/s. What is the jogger's
kinetic energy

Answers

Answer:

89.6Joules

Explanation:

Kinetic energy is 1/2MV^2

Where m is Mass and v is velocity.

M=81.6 v=2.2m/s

K.E= 1/2 × 81.6 × 2.2

= 81.6 ×1.1

K.E=89.6 Joules

Apply what you know about lipids to explain why the cuticle helps prevent water loss in plants. Compare it to what humans do.

Answers

Answer:

Explanation:

Waxy cuticle is a white powdery substance that is insoluble, it is found usually on the surface of stem or leave and it prevent excessive loss of water through transpiration.

It is an adaptive mechanism used in dry areas or desert to help plants retain water that is needed for their growth by reducing amount of water loss through transpiration.

Cactus is an example of plant with cuticle that thrive well in dry areas

Describe how ammonium ions can be converted to nitrate ions in the soil.

Answers

Answer: upon application diluted ammonia make the soil more alkaline

Explanation:

Which plants have difficulty getting the nutrients they need

Find a recent article that is centered around life science and give a report about it.....answer these 3 questions: 1) How is this article related to life science? 2) What interesting information did you read about in this article? 3) Why would this article be important for others to read?

Answers

I think the answer is A but I’m not sure have a great day buddy let me know if I can help with anything else

Which of the following groups makes up a system?

a. cell membrane, nucleus, cytoplasm
b. stomach, eyes, ears
c. heart, blood vessels, capillaries
d. food molecules, mouth, stomach

Answers

C. Heart, blood vessels, carpillaries

As fast as you can, name the planets in order from the sun.

Answers

Answer:

Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus, Neptune

Explanation:

Thenks and mark me brainliest :))

Answer: mercury, Venus, earth mars, Jupiter, Saturn, Uranus, Neptune,

and 15 years ago Pluto

Explanation: i should get extra for saying pluto

what is the botanical name of milk​

Answers

Answer:

Milk of magnesium's scientific name is magnesium hydroxide, and the scientific name for milk of sulfur is precipitated sulfur.

The botanical name of milk is not applicable, as it is not a plant or a plant product. Botanical name is the scientific name given to plants, fungus and algae.

Milk is a nutrient-rich fluid produced by mammals. It is frequently consumed as a source of nutrients and is renowned for having a lot of calcium. Water, lipids, proteins, carbs, vitamins, and minerals are all present in milk in complicated proportions.

There is no particular botanical name for milk in the field of biology, which is the study of plants and their categorization. Different plant species are identified and categorized using botanical names.

Milk lacks a botanical name since it is a byproduct of animals, not plants.

Learn more about botanical names here:

https://brainly.com/question/20532715

#SPJ6

a scientific ________ is based on the results of numerous experiments.

Answers

Answer:theor

Explanation:

b

Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3

Answers

It should be
AGATACCATGGTTACCCGGTTCCA

¿Cual es la importancia biológica de los estímulos umbrales?

Answers

Answer:

En electrofisiología, el potencial umbral es el nivel crítico al que debe despolarizarse un potencial de membrana para iniciar un potencial de acción.

Explanation:

En neurociencia, los potenciales de umbral son necesarios para regular y propagar la señalización tanto en el sistema nervioso central (SNC) como en el sistema nervioso periférico (SNP).

Espero que esto ayude :))

An increase in stimuli to the brain results in an increase in the responses of an organism. TRUE OR FALSE?

Answers

Answer:

True

Explanation:

As the intensity of stimulus increases abruptly then response increase in continuous as different absolute intensities. In fact the brain is able to respond to the differential change in magnitude of stimuli and not the absolute change in magnitude.

Hence, the given statement is true

Which of these statements is true of sexual reproduction?

HELP PLEASE HURRYYY!!!!!

It requires two parents and results in offspring that have characteristics of each parent.

It requires one parent and results in offspring that are genetically identical to the parent.

It requires two parents and results in offspring that are genetically identical to one parent.

It requires one parent and results in offspring that have half of the genes of the parent.

Answers

Answer:

A

Explanation:

Sexual requires two parents and will increase genetic variation

Hope this helps

Answer:

2nd one

Explanation: Dont have one

NO LINKS! NO PDF'S! NO FILES! JUST ANSWER!!! PLEASE HELP ASAP

Answers

(1. Physical adaptation (2. Behavioral ( 3. physical adaptation (4.behavioral (5. physical (6. behavioral (7. physical (8. behavioral (9. physical (10. behavioral (11. behavioral (12. behavioral

To review, what are the three main types of symbiotic relationships?
A. mutualism. commensalism, and parasitism

B. mutualism, community, practice

C. membership, commensalism, property

Answers

Answer:

A

Explanation:

The three main types of symbiotic relationships are mutualism, commensalism and parasitism

is the A is the one that has the most logic to your question

1. The process of translation is responsible for producing which type of molecule?

A. Polypeptide
B. RNA strand
C. DNA strand
D. New gene


Answers

rna strand im pretty sure

Identify and explain one aspect of your public speaking skills that you can improve. How can you work to improve this aspect?

Answers

Answer:

improve not moving around when you talk

Explanation:

being loud and projecting your voice is a hug part of public speaking

What are the products of photosynthesis?

Answers

Answer:

The reactants for photosynthesis are light energy, water, carbon dioxide and chlorophyll, while the products are glucose (sugar), oxygen and water.

Explanation:

This is where I got the information:

sciencing.com/reactants-products-equation-photosynthesis-8460990.html

I hope this helps!

PLEASE HELP! WILL GIVE BRAINLIEST. Describe the contribution of photosynthesis and cellular respiration to the exchange of carbon between the atmosphere and the biosphere.

Answers

Cellular respiration and photosynthesis are essential to the carbon cycle because cellular respiration involves the intake of oxygen o2 and the exhale of carbon-dioxide co2 into the atmosphere. Where photosynthesis uses the carbon dioxide and water to create oxygen and sugars through energy to repeat the cycle. Respiration in general is a process where carbohydrates are turned into dihydrogen monoxide or water and co2(carbon dioxide). Living organisms together throughout the biosphere and atmosphere work together to continue this because carbon itself is an organic substance.

Answer:

Explanation:   Cellular respiration and photosynthesis are important parts of the carbon cycle. The carbon cycle is the pathways through which carbon is recycled in the biosphere. While cellular respiration releases carbon dioxide into the environment, photosynthesis pulls carbon dioxide out of the atmosphere.

A man is HH for a trait, while his wife is hh. What will their children

Answers

Explanation:

I hope what I have drawn on the picture will help you understand:)

Other Questions
The group is planning to build a fence around the garden. How many yards of fencing materials do they need for the fence? Show your workI WILL GIVE 90 POINTS AND BRAINLIEST!!! Please help! This is timed!Read the excerpt from Gentleman of Ro en Medio.I sent a messenger up to the mountains for Don Anselmo. It took a week to arrange another meeting. When he arrived, he repeated his previous preliminary performance. He wore the same faded cutaway, carried the same stick and was accompanied by the boy again. He shook hands all around, sat down with the boy behind his chair, and talked about the weather.Don Anselmo continues to wear the same clothes after the sale of his land which shows thatA. he does not see any value in money. B. the appearance of wealth is not important to him.C. he does not believe he will get the money he is owed.D. the meeting with the narrator is not important to him. Jill is deciding whether to wear her pink shirt (P) or her white shirt (W). Then she must choose between her blue coat (B) or her green coat (G). Which list shows all the possible outcomes for Jill choosing one shirt and one coat?possible answersA)P-W, B-GB)P-B, W-GC)P-W, P-B, P-G, W-B, W-G, B-GD)P-B, P-G, W-B, W-GWill give brainlist!! 2. What is a line of symmetry?(1 Point) 2.1. Name the above nutrient cycle The author wanted to revise this story to allow readers to understand more fully how Coach Wilkins felt about the banquet and his career. What change would be MOST effective? Include the point of view of the coach by adding his thoughts and dialogue. A) Remove all the details about Josh, the cafeteria workers, and Principal Edwards B) Include more information on the activities with which Coach Wilkins was involved. Change the details to have Coach Wilkins deciding to teach social studies and coach footbalL D) y Comprehension helllpp?!?plzz do all of themand youuu get branlist!!!! and a thank you!!!_______________________________________________________1. Minds On: Theme Proportional ReasoningHow much are 5 dozens?( the pic) Do you know what a ratio table is? Here is one sample for you.______________________________________________2. Action:Read this problem 2-3 times and think about how you can solve this problem using the ratio table.Problem:A recipe that makes 5 dozen cookies You need 4 eggs and 2 cups of flour. Wolfgang has only 3 eggs. How much flour should he use? How many cookies can he make?How much of each ingredient would he need to make 75 cookies? Here is one started for you.( the pic) 3. ConsolidationWrite another problem and ask a friend to solve it.(plzz help me on this one too!!!) __ The Roman economic system was agrarian which revolved around . a Manufacturing b Farming c Service jobs d Producing textile goods (a)The measure of the minor arc in the circle shown below isdegrees.210Part BIf the radius of the circle is 12 inches, the area of the sector contained by the minor arc and two radii is:(b)357 in.B 557 in.2607 in.2D757 in. Remplissez les tirets avec le pronom relatif compos1. Cest une amie _______________ je prte quelque fois des livres.2. Ce sont des tudes ________________ je mintresse.3. Il cherche le dossier ________________ il avait mis ses papiers importants.4. Elle veut sauver les enfants _____________ elle prie.5. Tu connais le professeur ________________ je travaille ?please urgent Confused , Very much What types of regulations are designed to bring awareness to and reduce the amount of air pollution?clean air actsindustry regulation actspollution for the people actswater pollution controls When a 11.9 gram sample of copper metal is dropped into a glass of cold water, the temperature of the copper drops from 55C to 47C. The specific heat capacity of copper is 0.39 J/gC. How many Joules did the water absorb from the copper?a- 55b- 15.5c- 9.7d- 31.1 Which event occurred during the Cenozoic era?Volcanoes and earthquakes made the surface of the Earth hot and broken.Pangaea, the supercontinent, began to break apart.Cyanobacteria begin to fill the air and water with oxygen.Humans lived on Earth. I am a two digit number divisible my 19 the sum of my digits is 14 why do you think artists write their own songs? What is the volume of the right rectangular prism, in cubic centimeters?Vx9 cm3 cm4 cmcubic centimeters What was Cold War?????????? Please help, will mark brainiest! If you dont give fake answers, next qeustion will be more points