1. All of the following are examples of density- independent factors EXCEPT:
A) Weather
B) Predation
C) Natural disasters
D) Human activity

Answers

Answer 1
Answer is b hope this helps

Related Questions

The genetic composition of an organism is called the

Answers

Answer:

The genetic composition of an organism is called the genotype.

Como se chama a transferencia de enrgia termica flui de um corpo com maior temperatura quando ao outro de menor temperatura quando ha diferença de temperatura entre ambos

Answers

Answer:

Conduction.

Explanation:

Conduction is the process in which heat energy is transferred from the hotter body towards colder body because of temperature difference between two bodies. Conduction occurs only due to physical contact between two bodies. In the conduction process, the thermal energy flows from a body with a higher temperature to the other body having lower temperature until both bodies having same temperature.

PLs, help me with this biology question, please! (I will mark brainliest)

Answers

Answer:

guc is Val = valine

aca is thr =threonine

aug is Met = methionine

uca is Ser = serine

Explanation:

hope this helps

If air pollution causes the rain that falls on this pond to become much more acidic after two years how will this acidity
affect the living things in this pond?
There will be more plants and animals because the acid will kill most of the disease causing microorganisms
There will be more plants and animals because the acid is a source of food,
There will be fewer plants and animals because many of them cannot survive in water with high acidity,
D There will fewer plants and animals because the acid will dissolve many of them,

Answers

Answer:

the guy above me is correct

Explanation:

I know this isn't a explanation so I don't really know why I am putting it under the explanation category but I am really sorry if it is wrong

what are the 3 ways a species can become isolated and form new species? define what each of them mean.

Answers

Answer:

behavioral isolation, geographic isolation, and temporal isolation

Astronomers have made great strides in sending probes out to other planets and moons in our solar system. If they were to find a living creature some place other than Earth, how could DNA analysis help them better understand the organism? Explain in 1–2 sentences.(2 points)

Answers

Answer:

It could help them understand what ancestors they came from and what species they are most related to.

Explanation:

Food chains and food webs show how producers, consumers, an decomposers are connected to
one another as chemical energy flows through different
in an ecosystem
a. energy pyramids
b. trophic levels
c.biospheres
d. abiotic components
HELP WILL MARK BRAINLIST

Answers

Answer:

The correct answer is Choice B.

Explanation:

Hope this helps!

Please mark me as Brainlinieast.

Food chains and food webs show how producers, consumers, and decomposers are connected to one another as chemical energy flows through different TROPHIC LEVELS in an ecosystem.

A food web is a complex diagram that exhibits all of the food chains in a given ecosystem.

A food chain is a diagram that represents the transference of matter and energy (as food) from different trophic levels.

A trophic level is defined as a group of organisms in the ecosystem found at the same level in the food chain.

Producer organisms (e.g., plants and algae) are organisms that synthesize their own food.

Consumers (e.g., herbivores and carnivores) are organisms that need to eat organisms from a different population to survive.

Decomposers (eg. bacteria and fungi) are organisms that carry out the process of decomposition by eating dead plants and animals.

In conclusion, food chains and food webs show how producers, consumers, and decomposers are connected to one another as chemical energy flows through different TROPHIC LEVELS in an ecosystem (Option B is correct).

Learn more in:

https://brainly.com/question/13267087?referrer=searchResults

Question 5 of 10
As of the year 2000, the human population was approximately

Answers

Answer:

A. 6 billion

Explanation:

The full question is:

As of the year 2000, the human population was approximately _______.

A. 6 billionB. 3 billionC. 1 billionD. 10 billion

rashid is conducting a seminar on the importance of coral reefs which point should he include

Answers

Answer:

Protect coastlines from storms, erosion and provide habitat.

Explanation:

Coral reefs protect coastlines from storms and erosion as well as provide a habitat for thousands of aquatic animals. These points rashid must include in his seminar. Coral reefs are very important for the marine ecosystem because it can save the soil from erosion and decreases the intensity of storms by acting just like barrier. It provides food as well as living place for many organisms so these point are very important to be included in the seminar.

Answer:

that corals provide economic assistance to coastal populations through fisheries

Explanation:


DNA
Name:
1. What does DNA stand for?
2. Where is DNA found in eukaryotes? In prokaryotes?
3. What is the difference between chromatin and a chromosome? When can each be
seen?
4. How many letters are in the code of DNA?
5. Match the nucleotides
their partner:
Adenine
Cytosine
6. Fill in the complementary strand of the DNA.
CGTAGATG
ATGGCATCTACAAT GGCTICACO
TAAGCTG
7. Tell 3 functions that proteins serve in your body:
8. How are amino acids and proteins related?
9. In your own words, what does DNA do?
CLaney Lee 2019

Answers

Answer:

Please find the answers to the following questions below:

Explanation:

1. DNA stands for deoxyribonucleic acid

2. In eukaryotes, DNA is found in the nucleus of the cell while it is found in the cytoplasm of prokaryotic cells.

3. Chromatin is an uncondensed complex of DNA and histone proteins while chromosomes are a condensed form of chromatins. Chromatin can be seen during interphase stage of cell division while chromosomes become visible during prophase stage.

4. Three (3) letters are in the code of DNA. These three letters make up a codon.

5. Adenine - Thymine

Cytosine - Guanine

6. GCATCTACTACCGTAGATGTTACCGAGATTCGAC

7. Proteins are a part of the structural composition of the body

Proteins serve as catalyst for biochemical reactions

Proteins are source of nutrients

8. Amino acids are the monomeric units of proteins. This means that a protein molecule is composed of many amino acid units.

9. DNA is a molecule that stores genetic information in the cell of an organism.

Consider the satellite images that show topographical maps of Greece before and after fires of 2007. Imagine it is ten years
later.
Which prediction would not be consistent with a third satellite image of the area ten years in the future.
es )

Answers

Answer:

B) Ten years in  the future, that should be little or no change in the satellite  image that we will see

Explanation:

Its on usa test prep and I got it right

The prediction that would not be consistent with a third satellite image of the area ten years in the future is little or no change will occur.

What do you mean by Topographical maps?

Topographical maps may be defined as complicated, accurate graphic representations of features that appear on the Earth's surface.

Every year shows a drastic change in the topographical maps through satellites. It can be said that a period of ten years completely changes the whole sequence and positioning of lives living in a particular area.

Apart from geographical locations, technological advancements, climatic factors, and species may also alter.

Therefore,  the prediction that would not be consistent with a third satellite image of the area ten years in the future is little or no change will occur.

The satellite that detects the views of topographical maps is picturized below:

To learn more about Topographical maps, refer to the link:

https://brainly.com/question/1026002

#SPJ2

Why aren't human hunters a threat to polar bears anymore?

Answers

because the biggest threat to them is climate change!

Its because the Governments of the Arctic States are now regulating such people by  creating laws, restrictions and quotas to polar bear hunting. Some of those are:

-Amount of Polar bears that can be hunted

-Restriction to hunting certain age or gender

-Native people only being allowed to hunt them (excluding Canada) etc

Even capturing has quotas too. Those are:

-Who takes the polar bear

-Amount of Polar bears that can be taken

-The Life they will have while in captivity

‼️‼️‼️
PLEASE HELP WILL GIVE BRIANLIEST :))

Answers

Answer:

J SHAPED CURVE GIRL

Explanation:

HOPE THAT HELPS MUAH!

“When graphed, it appears as a J-shaped curve”, and “it occurs under ideal conditions with unlimited resources”

Please help me with this!!

1. Which process plays a part in genetic recombination? A. Asexual reproduction. B. Cytokines. C. Independent assortment. D. Mitotic division.

2. Which correctly lists the following terms in order from smallest to largest? DNA, chromatin, chromosomes, nucleosomes.
A. Chromatin, DNA, Chromatin, nucleosomes
B. Chromosomes,DNA, Chromatin, nucleosomes
C.DNA, nucleosomes, chromatin, chromosomes
D. Nucleosomes, DNA, chromatin, chromosomes

3. In a triploid organism, how many alleles are present for each gene per cell?
A. 1
B. 3
C. 6
D. 9

Answers

I) Independent assortment.

II) Nucleosomes, DNA, chromatin, chromosomes.

III) 3.

EXPLANATION:

Recombination scrambles pieces of maternal and paternal genes, which ensures that genes assort independently from one another.

➻ We know that Chromatin is a complex of DNA and proteins that forms chromosomes. Chromatin looks like beads on a string. The beads are called nucleosomes. Each nucleosome is composed of DNA.

Triploids with three different alleles can easily be detected because they have a unique phenotype.

The process involved in genetic recombination is INDEPENDENT ASSORTMENT. The correct order from smallest to largest is DNA, nucleosomes, chromatin, chromosomes. In a triploid organism, there are 3 ALLELES for each gene.

In independent assortment, different gene variants or 'alleles' are independently and randomly assorted into daughter cells, which allows genetic recombination.

In eukaryotic organisms, DNA is associated with histone proteins in order to form nucleosomes, which arrange in higher organization structures called chromatin fibers.

Subsequently, chromatin fibers condense to form structures called chromosomes.

A triploid organism (3n) contains three sets of homo-logous chromosomes, each one containing one allele for a given locus.

In conclusion, the process involved in genetic recombination is INDEPENDENT ASSORTMENT. The correct order from smallest to largest is DNA, nucleosomes, chromatin, chromosomes. In a triploid organism, there are 3 ALLELES for each gene per cell.

Learn more in:

https://brainly.com/question/10118000

Over time, a series of random occurrences can cause an allele to become more or less common in a population. This is called . When a population is severely reduced by an environmental disaster such as a fire, the result is a due to the reduced genetic diversity of the survivors. 3. The can occur if a small group of organisms migrates to a new location and becomes isolated from the rest of the population.

Answers

Answer:

Over time, a series of random occurrences can cause an allele to become more or less common in a population. This is called Genetic drift.

When a population is severely reduced by an environmental disaster such as a fire, the result is a Bottleneck effect due to the reduced genetic diversity of the survivors.

The Founder effect can occur if a small group of organisms migrates to a new location and becomes isolated from the rest of the population.

Explanation:

Genetic drift is an evolutive force. It is the random change that occurs in the allelic frequency of a population through generations. Its effects are harder in a small-sized population, meaning that the magnitude of this change is inversely related to the size of the original population.  

Genetic drift results in some alleles loss -including the beneficial ones-, while some other alleles get fixated. Low-frequency alleles are the most likely to be lost. The changes produced by genetic drift accumulate in time and results in a loss of genetic variability within a population.  

Genetic drift affects a population and reduces its size dramatically due to a disaster or pressure -bottleneck effect- or because of a population split -founder effect-. The bottleneck effect most likely affects smaller populations.  

The bottleneck effect -a case of genetic drift-, mostly affects smaller populations after the occurrence of a natural disaster or some human action -such as extensive hunting, for instance-. These events might act as a pressure that reduces significantly the number of individuals in a population. In these situations, some alleles are lost, and the survivors have a different genetic charge than the one of the original population. There might be a reduced genetic variability, with a possibility of developing a peculiar allelic component. If the survivors in the population carried or developed a mutation, probably this mutation passed from generation to generation.  

Founder effect refers to the origin of a new population from only a few individuals that are coming from a bigger-sized population. These founder individuals, which are carrying some of the genes of the original population, settle down in a new area and reproduce.  The new and small population might or might not be genetically representative of the original one. Some rare alleles might be exceeded or might be lost by complete. Consequently, when the small population increases in size, it will have a genetically different composition from the original one. In these situations, genetic variability is reduced, and there exists the possibility of developing a peculiar allelic composition. When the number of individuals that originated the new population is low, the founder effect will be very extreme because the genetic drift effects are inversely proportional to the original number of individuals.

Hello! Offering 25 points. I need it urgently.

Answers

The somatic nervous system transmits sensory and motor signals to and from the central nervous system. The autonomic nervous system controls the function of our organs and glands, and can be divided into the sympathetic and parasympathetic divisions.

,

Which of these does not represent a direct transfer of carbon

1.Air to trees
2.Giraffe to tree
3.Tree to Giraffe

Answers

The answer is tree to giraffe. Trees need carbon to make oxygen. Giraffes give off carbon when they exhale.

FREE BRANLIEST IF YOU ANSWER A foul ball can be caught by the defensive team for an out.

Answers

Answer:

TRUE!! IT CAN

why large spaces present between
spongy mesophyll cells​

Answers

These large spaces allow these layers to help carbon dioxide move around the leaf. The spongy mesophyll also allows the plant to bend and move in the wind, which itself helps move gases around the leaf's cells.


Can you please help me with this...

Answers

Answer:

A. Asexual

Explanation:

I majored in Biology

Does light have an effect on carbon dioxide production by plants and animals?

(No Links!! type the answer)

Answers

answer:

Light provides the energy for photosynthetic pig- ments to convert carbon dioxide (CO2) and water into sugars and oxygen. As light intensity increases – until a point – the amount of sugars increases and thus, more energy is available for plant growth and maintenance. hope this helps :D

Why is it important that the seedling’s true leaves grow quickly?HURRY IM BEING TIMED

to help disperse seeds to areas where they can grow
to shield the seedling from too much water or rain
to protect the seedling from receiving too much sunlight
to make food for the seedling’s continued growth

Answers

Answer:

The correct answer is - to make food for the seedling’s continued growth.

Explanation:

The true leaves that emerge from the seedlings are the leaves that are capable of performing photosynthesis and start generating food and energy. These support the plant for the rest of its life in terms of food and energy.

Seedlings grow from the soil, two leaves in beginning called cotyledons that are not the true leaves and not able to perform photosynthesis and generate their food for the seedling’s continued growth.

In holly trees, Red fruit (R) are dominant to white fruit (r), and spiny leaves (L) are dominant to smooth leaves (l). Complete the dihybrid Punnett Square to figure out how many of the new holly trees from this cross would be excpected to have white fruit and smooth leaves??


A. 1


B. 2


C. 3


D. 9

Answers

Answer:

All answers are in the image

100 points (50 each) How do workers decide when to set a controlled burn, and how do they know if they have been successful?

Answers

Answer:

It is very important to have the latest and most updated weather conditions available before starting the burn. Relative humidity is an important factor to consider when planning a controlled burn. If the relative humidity is below 50%, the dryness of the grass is prone to causing very hot fires

I've been looking around for the answer in this interactive website that was included within to answer these questions but, I couldn't find it and I'm wasting time looking for it.

Answers

Answer:

Iron is what mercury is mostly made of

What types of change can mutations have?

Answers

Answer:

Explanation:

Base Substitutions. Single base substitutions are called point mutations, recall the point mutation Glu -----> Val which causes sickle-cell disease.

Answer:

Types of Mutations

Missense mutation: This type of mutation is a change in one DNA base pair that results in the substitution of one amino acid for another in the protein made by ...

Nonsense mutation: A nonsense mutation is also a change in one DNA base pair. ...

Insertion or Deletion: An insertion changes the number of DNA bases in a gene by adding a piece of DNA.

Explanation:

What are ways that biodiversity loss can be reduced?
Select all that apply.
keeping seeds in seed banks
controlling invasive species
captive breeding
fragmenting habitats

Help FINAL EXAM please

Answers

I think the second one

Why can't polar bears survive on berries or eggs?

Answers

Answer:

Polar bears that are forced to live on land due to melting ice face lean times in most of the Arctic. Food found on land, such as berries and eggs, lack the high fat content and calories of the bears' preferred prey.

Explanation:

because they aren’t land animals and depend on fish

Which of the following is not a concern about nuclear energy?

Answers

Nuclear energy produces less carbon than fossil fuels

Organisms can pass on their genetic information through asexual reproduction. Asexual reproduction is a form of reproduction that involves ______ parent.

Answers

Answer:

1

Explanation:

the prefix A- means one

Other Questions
One bag contains 6 red, 2 blue, and 3 yellow balls. A second bag contains 2 red, 4 blue, and 5 yellow balls. A third bag conOne bag contains 6 red, 2 blue, and 3 yellow balls. A second bag contains 2 red, 4 blue, and 5 yellow balls. A third bag contains 3 red, 7 blue, and 1 yellow ball. One bag is selected at random. If 1 ball is drawn from the selected bag, what is the probability that the ball drawn is yellow? tains 3 red, 7 blue, and 1 yellow ball. One bag is selected at random. If 1 ball is drawn from the selected bag, what is the probability that the ball drawn is yellow? (PLEASE HURRY BRAINLY IF CORRECT)In Section 7, Phillip talks about Mrs. Narwin again, and the reason he received a bad grade in English. Write a letter (5 sentences) to Phillip, convincing him that he is wrong about Mrs. Narwin and why he received a D.OrWrite a letter (5 sentences) to Mrs. Narwin, convincing her that Phillip is not like she thinks and deserves a better grade and why. Your answer: please answer all 20 questions What changes when a cell divides into two daugther cells to make it easier for the cells to exchange materials across the surface of the cell? A. Cell division does not make it easier to transfer materials across the cell surface. B. The new cells move materials faster. C. Each new cell has an increased surface area to volume ratio Is a triangle with side lengths of 33 inches, 56 inches, and65 inches a right triangle? Explain your reasoning. Melanie and Brody want to find out whether wooden bats or metal bats allow baseballs to travel farther. Melanie asks five different people to hit ten balls with each type of bat and she measures the distance each ball travels. Brody researches the physical properties of the pine wood and the aluminum metal and then estimates the possible distance a ball could travel with a given force.Which student conducted an experiment and which student conducted an investigation? Explain your answer. Which human body process offers a clear example of positive feedback?blood pressure regulationbody temperature controlinsulin controlling blood sugarblood clotting caused by thrombin $6000 principal earning 3% compounded annually, 8 years I know this does have to do with school or math but does anyone know if baking soda can clarify your hair is 5.2315532152535121 a rational number Adam writes the following hypothesis, "Grasshoppers prefer plants with higher levelsof sugar content". His hypothesis was not supported by his data but he wants to findout if other insects prefer plants with higher levels of sugar in them. Why is hisoriginal hypothesis still valuable?It involves the study of insectsIt was disprovenIt is clearly writtenIt can lead to further investigations Select the verbal irony in the passage. 8/2(2+2) I already know the answer, I just wanna know whether people think it's 16 or 1 If 25% of a number is 50 and 35% of the same number is 70, find 10% of that number. Anyone know the answer to the first one? Select all correct conversions.0.6 km = 6,000 m7.5 m = 0.0075 km46 m = 4,600 cm457 mm = 4.57 cm0.31 m = 310 mm*There is multiple answers* Help plesae i have no idea of what to do thanks what should I do to decrease the temperature from the Cryogenian period? Cindy, Hao and Raymond have some books. Cindy has three times as many books as Hao and Raymond has half as many books as Hao. Between the three of them, the mean number of books that each person owns is 15. How many books does each person own? Rewrite this sentence using correct punctuation and capitalization: Flossy returns is the first chapter in my new book.