1. 4 ⅙ ÷ 5
2. ⅝ ÷ ¾
3. ⅗ ÷ ⅜
4. ⅜ ÷ ⅝

i am dying help me.

Answers

Answer 1

Answer:

number 1 is 0.83333333333

Step-by-step explanation:

Answer 2

Answer: 1. 0.83 or fraction: 5/6

2. 0.83 or fraction: 5/6

3. 1.6 or as a fraction: 1 and 3/5 or improper: 8/5

4. 0.6 or as a fraction: 3/5

Hope this helps! :)


Related Questions

Mr Ramos is going to build a square-shaped room onto his house. Mr. Ramos wants the room's length to be as close to 10 ft as possible. Which area should his room have to give him the side length closest to 10?

Answers

Answer:

100ft²

Step-by-step explanation:

The problem here is to find the area of the room that will give a length of 10ft.

  Note;

 The room is a square room.

Now let us solve this problem;

   Area of a square is:

    Area = L²

Where L is the length of the room;

So the area of the room is;

    Area = 10² = 100ft²

The area of the room that will give a length of 10ft is 100ft²

. What is the measure of in nearest degree, If Sin 0 = 4/9
a) 70°
b) 26°
b) 64°
d) 83

Answers

Answer:

think I would be ....... b) 64°

please help! will give brainliest!! financial lit.!
The law of supply states that producers will supply _____ goods or services when the price is _____.
a. fewer; high
b. better; high
c. fewer; low
d. more; low

Answers

Answer:

b. better; high

Step-by-step explanation:

whats 45 x 7^5 + 809 -12

Answers

Answer:

757112 or 7.57112 x 10^5

Step-by-step explanation:

45 x 7^5 + 809 - 12

45 x 16807 + 809 - 12

756315 + 809 - 12

757124 - 12

757112 or 7.57112 x 10^5

Which of these equations is in POINT-SLOPE form?

m=(2−4)(5−3)
m is equal to the fraction with numerator open paren 2 minus 4 close paren and denominator open paren 5 minus 3 close paren

y=4x+7
y is equal to 4 x plus 7

y−3=23(x−4)
y minus 3 is equal to 2 thirds times open paren x minus 4 close paren

3 x + 5 y = 8
3 x + 5 y = 8

Answers

Y-3=23(x-4) hope this helps

what is 800x864674 divided by 500?

Answers

Answer:1383478.4

Step-by-step explanation:The answer is 1383478.4 and i dont think it can be simplify

what is the range of y = -x + 3 if the domain is {-2,0,2,4}?

Answers

Answer:

i dont know

Step-by-step explanation:

i is spelt with i, and so on.  

4x−3/2 - 5-2x/3 - 3x-4/3 = 5

Answers

Answer:

Simplify the expression.

2x-47

=6

Step-by-step explanation:

Answer:

x= -8.5

Step-by-step explanation:

combine like terms

1/3x - 47/6 =5

2. Get x onone side

1/3x = -17/6

3. Multiply for x

x= -8.5

1) The standard form of a linear equation is written as .
ax + by=c
a. Write the equation in slope-intercept form( y= mx + b)

b. Write the slope, y-intercept form of (a).
PLS HELP

Answers

Answer:

[tex]\displaystyle y=-\frac{a}{b}x+\frac{c}{b}[/tex]

Step-by-step explanation:

The equation of the line, expressed in slope-intercept form is:

[tex]y=mx+y_o[/tex]

Where m the slope and yo the y-intercept.

Since we are given the line in standard form:

ax+by=c

To find the slope-intercept form, we just solve it for y:

[tex]\boxed{\displaystyle y=-\frac{a}{b}x+\frac{c}{b}}[/tex]

Comparing the last equation with the slope-intercept form:

[tex]\displaystyle m=-\frac{a}{b}[/tex]

[tex]\displaystyle y_o=\frac{c}{b}[/tex]

Answer:

ax + by = c

-ax     -ax

by=ax+c

then dived both sides by b to get y by itself

y= a/bx +c

Step-by-step explanation:

Jessica has collected bead all
Summer She started with 50
summer this summer then she was able to add 34
To her cullection she wanted to give 4 friend some beads how many beads will each friend get

Answers

21 to each friend because 84 divided by 4

move vertices A B and C to modify the original parallelogram. As you change the parallelogram, notice what happens to the diagonals. How does moving the vertices affect the relationship between the diagonals that you noted in question 2?

Answers

Moving the vertices does not affect the relationship between the diagonals. They bisect each other in all cases.

Answer:

Despite changing the vertices, the opposite sides and opposite interior angles of the parallelogram remain equal.

Step-by-step explanation:

PLATO AWNSER

what is the y-intercept?

Answers

Answer:

the y intercept is -2

Step-by-step explanation:

If you look at the pattern of the y values, it's just adding one every time. so when x=o y=-2

The y-intercept is -2

4 Sam was asked to place the numbers shown below in order from least to greatest.
1/-0.5, 8,
.*,-0.66, 1.22
After ordering the numbers from least to greatest, what number would Sam have in
the fifth position?
F 1.22
G350%
H 1
3

Answers

Answer:

0 .66

Step-by-step explanation:

Because they were big than other no

i need help please!!!!

Answers

Answer:

1/12 i hope this is correct i think so i did it in my calculator so i hope it helps

Step-by-step explanation:


The sum of two numbers is 48. If the second number is 6 less than the first, what
is the value of EACH of the numbers?

Answers

Answer:

let the first no. be x

then the second no. = x - 6

their sum is 48

therefore,

[tex] = > x + (x - 6) = 48 \\ = > 2x = 48 + 6 \\ = > 2x = 54 \\ = > x = \frac{54}{2} \\ = > x = 27[/tex]

The value of first no. = x = 27

The value of second no. = x - 6 = 27 - 6

= 21

What’s 6e+3e-7e simplified

Answers

Answer:

2e

Step-by-step explanation:

6e + 3e - 7e

= 9e - 7e

= 2e

Answer the following above:

Answers

Answer:

-3.25

Step-by-step explanation:

Just multiply -0.5 and 6.5.

2(9 + 4x) + 6(2 - x) = 7x. i need help asap pleasee

Answers

Step-by-step explanation:

18 + 8x + 12 - 6x = 7x

30 + 2x = 7x

30 = 7x - 2x

30 = 5x

Divide both sides by 5

X = 6

please help At a bake sale there were 50 items sold total. If 5 of the items sold were cookies and the rest were brownies what is the ratio of brownies sold to cookies sold?

Answers

Answer:

45:5 or 45 to 5

Step-by-step explanation:

If 5 of them were cookies then that leaves the rest of them (which is 45) to be brownies. So it would be brownies to cookies which equals 45:5

Anand needs to hire a plumber. He's considering a plumber that charges an initial fee of $65 along with an
hourly rate of $28. The plumber only charges for a whole number of hours. Anand would like to spend no more
than $250, and he wonders how many hours of work he can afford.
Let H represent the whole number of hours that the plumber works.
1) Which inequality describes this scenario?
Choose 1 answer:
a
28 + 65H <250
28 + 65H > 250
© 65 +28H < 250
D
65 +28H 250

Answers

65+28H≤250

Step-by-step explanation:

Anand can afford at most 6 hours.

Step-by-step explanation:

Solve -9 2/7 - (-10 3/7)

Answers

Answer:

= 8/7

Step-by-step explanation:

-65/7 -( -10 3/7

- 65/7 -( - 73/7)

= -65/7 + 73/7

=8/7

Answer:

1 1/7

Step-by-step explanation:

Answer:

= 8/7

Step-by-step explanation:

-65/7 -( -10 3/7

- 65/7 -( - 73/7)

= -65/7 + 73/7

=8/7 or 1 1/7

What is the slope of this equation?y= -1/2x −3 Question 2 options: 0 -3 -1/2

Answers

Answer:

-1/2

Step-by-step explanation:

In the equation y=mx+b..

y and x are the coordinates that go into your function

m is the slope

and b is the y intercept

looking at y=-1/2x-3 i can tell that -1/2 is in the place of m which is slope, and -3 is the y intercept.

Eloise bought 2 boxes of crackers to share with her friends. Her friends ate 12 of the first box and 23of the second box.

How many boxes were left over?

Answers

Answer:

how many are in one box?

Step-by-step explanation:

Answer:

5/6 box

Step-by-step explanation:

confirmed!

What is the range of the function shown on the graph above ?

Answers

Ummm...person...you do know  we need to see the graph, not the answers, right?

Answer:

Step-by-step explanation:

It's the-9 one

One gram of protein contains 4 calories. One gram of fat contains 9 calories. A snack has 80 calories from x grams of protein and y grams of fat. 80= 4x + 9y

If there are 6 grams of fat in the snack, how many grams of protein are there? Show your reasoning.

Answers

Answer:

6,5g of protein

Step-by-step explanation:

80=4x + 9y

y=6 ( "6 grams of fat")

so: 80=4x+9.6

80-54= 4x

26/4=x

x(protein)= 6,5

Answer:

  6.5 grams

Step-by-step explanation:

To find the value of x that corresponds to the given value of y, put that y-value into the equation and solve for x.

  80 = 4x +9·6

  26 = 4x

  26/4 = x = 6.5

There are 6.5 grams of protein in the snack.

150 x + 500 > 2000
What is the solution

Answers

Answer:

X > 10

Step-by-step explanation:

whas does 16g+3<-17+15g equal ​

Answers

Answer:

g∠-20

Step-by-step explanation:

Please help you guys

Answers

Answer:

It should be 21.1

Step-by-step explanation:

Can someone help me with this

Answers

1) y > 19
2) x < 8


Hope this helps!

8c - 6c + 14 = 12 what is c

Answers

Answer:

c= -1

Step-by-step explanation:

combine like terms

2c+14=12

subtract 14 from both sides

2c= -2

divide 2 on both sides

c= -1

HOPE THIS HELPS!!

Other Questions
HELP ASAP WILL MARK BRAINLY BRAINLIEST What stage of cellular respiration uses the high-energy electrons from NADH and FADH2 to form ATP molecules? Krebs cycle Electron transport chain Fermentation Glycolysis 3.Where do you fall in the "life isn't fair, deal with it" debate? Is this a good or bad way ofthinking about your life? Explain your answer. How are the barber and Captain Torres alike? *they both do their jobs extremely wellthey both do their jobs honorablyboth options are correctO neither option is correctWhich answer is correct Solve the following and explain your steps. Leave your answer in base-exponent form. (3^-2*4^-5*5^0)^-3*(4^-4/3^3)*3^3 please step by step!!!! Which option is considered a part of the document that is used to collect specific and predefined information?O text boxO WordArtO SmartArtO form 4. Root cells of plants take in some minerals from the surrounding soil by spendingenergy. After the plant obtains enough minerals to maintain health, the plant willcontinue to absorb minerals from the soil. Which reason best explains why root cellsneed to spend energy in order to transport some minerals into cells? According to this opinion, what does the Supreme Court believe?A minors age does not need to be taken into account when determining if he is in police custody.A minors age must be taken into account when determining if he is in police custody.All accused must be treated equally.J.D.B. was innocent of the crimes to which he confessed. if you ride your bike around the block, returning to the exact point where you started, your displacement is _____m?help please In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Calculate the mmoi of a tire that weighs 15.0 kg and has a radius of 30.0 (treat it as a hoop ) essay on my future ambition as a teacher After conquering China, the Mongols created theHan Dynasty.Ming Dynasty.Song Dynasty.Yuan Dynasty. P5.30 Having a secure password is a very important practice, when much of our information is stored online. Write a program that validates a new password, following these rules: The password must be at least 8 characters long. The password must have at least one uppercase and one lowercase letter. The password must have at least one digit. Write a program that asks for a password, then asks again to confirm it. If the passwords dont match or the rules are not fulfilled, prompt again. Your program should include a function that checks whether a password is valid. The concentration of the solute in the solution is the same as in the cell the rational number 9.8 is the best approximation to the tenth of which irrational number?89 squared92 squared96 squared98 squared Which of the following reasons led the Texans to revolt against the Mexican government? A. A tax on cotton? B. Outlawing Slavery? C. Annexation of California? or D. Forcing Texans off their land? Why did slavery come to a halt in the 1750s? i need help with this too please A random telephone survey of 1021 adults (aged 18 and older) was conducted by Opinion Research Corporation on behalf of CompleteTax, an online tax preparation and e-filing service. The survey results showed that 684 of those surveyed planned to file their taxes electronically.a. Develop a descriptive statistic that can be used to estimate the percentage of all taxpayers who file electronically.b. The survey reported that the most frequently used method for preparing the tax return was to hire an accountant or professional tax preparer. If 60% of the people surveyed had their tax return prepared this way, how many people used an accountant or profes-sional tax preparer